Week 4 HW

1. how is information from the DNA passes on from one cell to another?2. How does the structure of a DNA molecule hellp account for the great variety of life that exists on earth?3. Does your mRNA model more closely resemble the DNA strand from which it was transcribed?4. Explain how the structure of DNA enables the molecule to be easily transcribed. Why it is important for genetic information?5. Why is RNA important to the cell?6. How does the mRNA molecule carry information from DNA?

1. Define the following terms DNA RNA Replication Translation Transcription 2. What is the central dogma of life? 3. Cite at least three fat-soluble vitamins and provide their functions 4. Cite at least three water-soluble vitamins and provide their functions 5. What are minerals? Why are they important to the body?

1. Determine what amino acid will be formed from the given  DNA strand below:                          3’   T   A  C   A   T   G   C   C   G   A   A   T   G   C   C   5’   2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA.  3.  Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.

6. James Watson and Francis Crick were the two scientists who received credit for identifying the structure of DNA. They based their findings on the work of Rosalind Franklin. Group of answer choices True False 7. Transcription uses a strand of DNA as a template or copy and makes a new strand of RNA which is used to eventually code for proteins. Group of answer choices True False 9. After the process of DNA replication, there are two newly formed strands of DNA in each double helix. Group of answer choices True False   plz aNSWER ALL

1. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? Group of answer choices a. 5' TTACCGAAT 3' b. 3′ AATGGCTTA 5′ c. 5′ TAAGCCATT 3′ d. 3′ TTACCGAAT 5′   2. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices a. C b. G c. A d. T   3. A scientist, Dr. Doom would like to create a novel antibiotic by targeting translation in bacterial cells. Which enzyme(s) would Dr. Doom need to target to prevent translation at the transcriptional stage?  Group of answer choices a. RNA Polymerase…

Within the Central Dogma, what is the primary function of DNA?   a. make proteins   b. preserve nuclear integrity   c. maintain the genetic information   d. keep a boundary between RNA and Protein

Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions   5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’   a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest?     b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect?   2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a)  HpaI, recognizes 5’ GTT – AAC 3’   5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’   Number of fragments of DNA:…

1. Explain the concept of central dogma of biology 2. Explain the definition of DNA replication and list general steps of Replication  3. Explain the definition of Transcription and list general steps of Transcription

Compare and contrast transcription and DNA replication. Consider the proteins involved, the template, the products, and the mechanism of synthesis.

Wish of the following statements is true about DNA? a. DNA is the hereditary material in almost all organisms b. The replication of mitochondrial DNA is controlled by nuclear DNA c. Most DNA is found in the mitochondria d. Human nuclear DNA consists of one polynucleotide that carries all e. Mitochondrial DNA controls most of the cell activities Question After using the blender to blend the split peas, water, and salt mixture, cheesecloth is used to ......... a. Filtrate the mixture and precipitate the protein b. Filtrates the contents of the blender to collect the strained fluid for DNA extraction c. Separate the DNA from the protein that folded and protected the DNA d. Collect pure nucleic acid e. Precipitate the nucleic acid acidgenetic information

1. Describe the relationship between chromosomes, cells, and DNA2. [Use Pictures]       - How does the model describe about the structure of DNA3. Why do scientists use models? What are the limitations of models?

new DNA molecule is precisely synthesized during the following EXCEPT? A.Trasformation B. Transcription C.Translation D.Replication

Item33       Item 33   The function of the nucleolus is to make   Multiple Choice   DNA molecules.   the subunits of ribosomes.   the secretions that will be packaged by the Golgi apparatus.   histones.   the deoxyribose sugar. Item34       Item 34   The building blocks that form the DNA double helix are called   Multiple Choice   nucleoli.   nucleotides.   steroid bases.   nitrogenous acids.   nuclear pores. Item35       Item 35 Which of the following is considered a required enzyme for the process of transcription? Multiple Choice   Aminoacyl-tRNA synthetase   DNA polymerase   RNA polymerase   Amine transferase

What are major functions that DNA polymerase performs?   A. unzips the DNA strand and makes the new nucleotides   B. proof reads the new DNA strands for errors and corrects them   C. bonds the nucleotides together forming the new DNA strand   D. A, B, and C   E. A and B   F. B and C   G. A and C

Illustrate some steps involved in DNA replication :Suppose the following base sequence was found in a segment of one strand of a DNA molecule: 3’ A-A-T-A-C-C-T-C-C-T-A-A-C-T 5’ What would be the bases in the complementary strand? Label the 3’ and the 5’ ends. Illustrate the DNA molecule below. Label the 3’ and the 5’ ends of both strands. Separate the above DNA molecule up to the seventh base. Add one primer for the leading strand complementary to the first base Adenine of the template strand. Add one primer for the lagging strand complementary to the seventh base Adenine of the template strand. Illustrate the DNA molecule. Label the 3’ and 5’ ends. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate the resulting DNA molecule. Label the 3’ and the 5’ ends of the template strands and the complementary strands. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate…

For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA template? [2] What is the sequence of the informational strand of the DNA molecule? a. 3 '–TGCCTAACG–5 ' c. 3 '–TTAACGCGA–5 'b. 3 '–GACTCC–5 ' d. 3 '–CAGTGACCGTAC–5 '

Determine what amino acid will be formed from the given DNA strand below:                          3’   T   A  C       A   T   G         C   C   G   5’ 1.  Partner DNA strand 2.  the mRNA strand 3.  the tRNA  4.  the formed amino acids

Describe the final steps that take place once synthesis of the DNA strand is complete.

Draw a Concept Map of the Central Dogma in order to summarize and connect the concepts. Write DNA–>RNA–>protein in the center of your page. Add the essential terms (objects and processes) on the post class pages for replication, transcription and translation.

(a) What is the function of helicase in DNA replication?(b) What is the function of DNA polymerase?(c) What are replication forks? Compare and contrast leading and lagging strands. Answer all please