5. Salivary a-amylase cleaving a(1 example for which type of specificity? a) Group specificity b) Bond specificity c) Reaction specificity d) Broad substrate specificity 4) glycosidic bond of carbohydrates is an
Q: 1. Shown below is a metabolic pathway: Es E4, E F > E1 E3 A - B C - D E2 E6 R E7 Es Suppose we have…
A: Note : Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Briefly describe the following and give examples. 1. Starch 2. Glycogen 3. Protein
A: There are four classes of biological macromolecules: nucleic acids, lipids, proteins and…
Q: A 1% by weight agarose gel is typically used in agarose gel electrophoresis. If you used a 2%…
A: During agarose gel electrophoresis, an agarose solution is prepared, it is cooled to prepare a gel,…
Q: Which amino acid(s) are more commonly found at the At which position(s) are amino acids limited to…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which of the following is NOT true regarding nicotine? a. its psychoactive effects include…
A: Nicotine is a toxic substance present in tobacco. Nicotine is addictive and is hard to quit. It…
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars
A: One of the three major nutrients is carbohydrates. Sugar is a common name for them. They can be…
Q: 1. Write the ten reactions of the glycolytic pathway, naming all enzymes and providing the…
A: Glycolysis is a process in which one mole of glucose is partially oxidized into the two moles of…
Q: CH,0--o CH;0-P-O ČH-OH C=O Ó. 10-C-H H-C-OH H-C-OH O C-H ČH;O-P-0 H-C-OH O CH-O
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: The table below summarizes the results for Xanthoproteic test. Provide the correct remarks from the…
A: Proteins are big, complex molecules that serve a number of important tasks in the human body. They…
Q: 3- Planning, implementation and evaluation
A: Health Sector is the most important sector of today's world which includes which includes hospitals,…
Q: Draw and label a structure of: A diglyceride of oleic acid
A: A diglyceride is composed of a glycerol molecule attached to two fatty acids through ester bonds.…
Q: 7. Which of the following is an example for a ribozyme? a. transpeptidase b. glutamyl transpeptidase…
A: Introduction: Ribozymes are ribonucleic acid enzyme that is capable of catalyzing specific…
Q: Describe surroundings at home which reminds you about biochemistry and relate the situation to…
A: related to this : proteins A situation to describe : Cooking
Q: Diagram to compare & contrast CATABOLISM vs ANABOLISM such as its process/mechanism, relation with…
A: Anabolism and Catabolism are the two broad type of biochemical reaction in metabolism where…
Q: Phospholipids have ____ fatty acids while triglycerides _____ fatty acids.
A: Lipids are defined as organic substances insoluble in water but soluble in organic solvents like…
Q: The activity of isocitrate dehydrogenase in E. coli is regulated by the covalent attachment of a…
A: Isocitrate dehydrogenase is an important Enzyme of TCA cycle for the conversion of isocitrate into…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: What is the final enzyme used in the biosynthesis of stearate (C18:0)? A. Elongase B.Beta-Ketoacyl-…
A: Fatty acid biosynthesis occurs in the cytoplasm of the cell. Fatty acids are the long-chain…
Q: Succinyl-CoA Synthetase mechanism Succinyl-CoA synthetase enzyme active site O Substrates bind to…
A: Succinyl-CoA-Synthetase: This is an enzyme of TCA cycle catalyze the conversion of Succinyl-CoA to…
Q: 1. In one (1) sentence point out a key structural similarity and difference in each of the following…
A: There are 4 Biomacromolecules . They are carbohydrates, proteins , lipids and nucleic acids. Each of…
Q: 1.Antibiotics that are active against G= and G- organisms such as Blank 1, Blank 2, and Blank 3…
A: Hi! Thank you for the question. We are authorized to answer two subparts at a time, since you have…
Q: What role does superoxide dismutase play in ameliorating the effects of reactive oxygen species?…
A: Superoxide dismutase: This is a very important Enzyme that protects the living cells from harmful…
Q: According to the search results from question 7, which of the following lipids is (currently) only…
A: Human body contains many sialic acid containing gangliosides or glycosphingolipids such as GM1,…
Q: ince in this patient, pyruvate kinase is abnormal not only is less pyruvate made but intermediates…
A: Introduction: Pyruvate kinase is the last enzymatic reaction in the glycolysis pathway. It is…
Q: Explain what Hepatocyte hopping is
A: Introduction: The liver is the modified exocrine gland and liver cells are made up of hepatocytes.…
Q: Make a concept map covering about the following: a. SYPHILIS b. Anti-Streptolysin O Test (ASO TEST)…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Procedure: 1. Dissolve one teaspoon or one packet of active yeast in a small amount of warm water.…
A: Hi, thanks a lot for submitting multiple questions and as you have asked to answer 5, 6 and 7…
Q: How can these deficiencies (a-KG dehydrogenase, Succinate dehydrogenase (SDH), Fumarase) negatively…
A: The mentioned enzymes are the essential part of metabolic pathways that helps in synthesis and…
Q: Millon's test is used to detect the amino acid, tyrosine. However, to solely use the qualitative…
A: The amino acid tyrosine has a phenolic group in its side chain.
Q: Which among the following correctly represents the characteristics of an anion exchanger O Anion…
A: Ion exchange chromatography a chromatographic method based on the net charge of the protein.
Q: value the cathode or anode). Protein eins wards Pepsin Lysozyme Hemoglobin Mynolohin IpH 1.0 11.0…
A: On basis of the gel used, electrophoresis is classified into 2 types, Agarose gel…
Q: 3. How do erythrocytes produce ATP? What is the role of ATP to red-cell morphology and function
A: Adenosine triphosphate (ATP) is an energy-carrying molecule particularly found in the cells of all…
Q: 1) Given the structure of pyruvate below, draw the reaction with NADH to form lactate. (only the…
A: Pyruvate is the end product of the glycolytic pathway. Under aerobic condition, the pyruvate…
Q: How does compromised pyruvate kinase activity lead to anemia? (3 sentences)
A: Pyruvate kinase is a glycolysis enzyme that plays a role in the last phase. It catalyzes the…
Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond…
A: The αα-helix is an ordered secondary conformation of proteins. An αα-helix is stabilized by the…
Q: 4. Why is the type of cell (aerobic/ anaerobic) important to the purpose of this enzyme?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: gel electrophoresis
A: Gel Electrophoresis is a simple , rapid and analytical technique which is used for separating the…
Q: Microbes can provide beneficial activities. Bioremediation (using bacteria) is a process used to…
A: Bioremediation is a waste management technique. Living organisms can be used in this process to…
Q: 5. Use this figure to summarize how the ATP is used as energy "currency", harnessing some of the…
A: ATP is used as a energy currency due to the presence of two high energy phosphoanhydride bonds…
Q: Which peptide will yield the following qualitative resul Millon's Test (+) Fohl's Test (+) Sakaguchi…
A: Introduction: Amino acids are the building block of proteins and are linked to a peptide bond. Each…
Q: HbA1c is a glycated hemoglobin in which a glucose molecule is covalently bound to the N-terminal…
A: Hemoglobin is an iron-containing oxygen-transport metalloprotein found in nearly all vertebrates'…
Q: Why is it necessary to study the diffusion of molecules in biological systems? (а.) To understand…
A: Diffusion is the process of random motion of molecules in which there is a net flow of matter from a…
Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Н. Based on what you know about the classification and structure of galactose, HO- what possible…
A: Galactose is a simple monosaccharide aldohexose and a C-4 epimer of glucose, and a precursor to…
Q: What part of the protein sequence leads to different functions
A: Proteins are peptides , composed of monomers of polymers,Protein function is directly related to the…
Q: Give the 3 major pathways that eventually become entry points of molecules into the Krebs Cycle.…
A: The Krebs cycle, or citric acid cycle, occurs in the mitochondrion of a cell. The citric acid cycle…
Q: Consider each of the following disaccharides: a) Label the acetal and hemiacetal in each…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Look at the structure of the disaccharide shown. Name the type of bond which is present. CH2OH H он…
A: Disaccharides exist in more than one chemical conformational structure. The alpha and beta forms of…
Q: topic: sds-page gel If APS is not available, what other chemicals can be used alternatively to…
A: APS stands for Ammonium Persulfate. It is an oxidizing agent that is used along with TEMED in order…
Q: A positive result for the Ninhydrin test yields a deep blue or violet-blue color of the soluti more…
A: Ninhydrin test is a chemical test performed to detect the presence of amines or amino acids.
Step by step
Solved in 3 steps
- Why isn't the cooking ofvitamin C-containing foodsappropriate for vitamin Csupply?1. Why do we need to prepare the meat before cooking?1.describe the effect of adding fluoride to drinking water. 2.where is saliva secreted into from the salivary gland 3.Where is gastric juice made containing pepsin and hydrochloric acid 4.where does amylase break down starch to maltose 5.where does mastication increase the surface area of the food 6.where does bile salts emulsify fats 7.where does pepsin break down protein to polypeptides 8.where is sodium hydrogen carbonate neutralises acid from the stomach 8.Where does lipase break down fats to fatty acids and glycerol
- 1. a. What macronutrient provides the most calories in this product? b. Is this product considered any type of chocolate? Why or why not?How do you account for the differences in the amounts of proteins, lipids, carbohydrates, and nucleic acids in the hydrolysed liver extract?What are the advantages of the fed-batch fermentation over the batch fermentation in production of amino acids?
- 1. Why is it important to pay attention to essential amino acids if you are a vegetarian/vegan?4. What are three enzymes present in saliva and function of any one of the enzyme?1- Which one of the following statements describes non - essential amino acids ? a) They can be synthesized from essential amino acids . b) They are ingested but not used in protein synthesis . c) They are stored in adequate amounts so are not needed in the diet . d) They are less important in cells than essential amino acids . 2- Some proteins contain additional amino acids that arise by modification of an amino acid already present in a peptide , examples include: a) Gamma Amino Butyric Acid. b) 5 - hydroxy Lysine c) 4 - hydroxy proline d) All of the above e) None of the above
- Why are protein-digesting enzymes secreted as zymogens? Cite at least 3 references.9. Why is the duodenum so low in bacterial populations whereas the ileum is so high?Coliform bacteria are common contaminants of meats.a. Why might one expect to find coliforms in samples of meat? b. High coliform counts in food indicate the potential for finding which intestinal pathogens? c.In terms of food safety, why is it suggested to cook hamburgers medium-well to well-done, whereas steaks can be cooked rare?