Answered: Here is the complete mRNA sequence from…

Name: Here is the complete mRNA sequence from a bacterial cell:5' ACUAGCAGGA
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Here is the complete mRNA sequence from a bacterial cell:5' ACUAGCAGGAGACGUAAGCGAUGUGCCAGAUGCGCAGUCACACAUAACUGCAAG 3'How many amino acids long is the protein?O: 6,O:12,O: 10O: 8O:4

Science

Biology

Here is the complete mRNA sequence from a bacterial cell: 5' ACUAGCAGGAGACGUAAGCGAUGUGCCAGAUGCGCAGUCACACAUAACUGCAAG 3' How many amino acids long is the protein? O: 6, O:12, O: 10 O: 8 O:4

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letter
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
Below is the DNA sequence of a gene, what is the protein sequence? 5'-GGTAAGCTAGCTATGACTACCCTGACATAGATATCGACTAGCTG-3' Insert the amino acid sequence using the single letter designation for the amino acid (ex: use ACG instead of AlaCysGly). Include only the letters in the correct order as they would be translated using no commas, no spaces and no dashes.
17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80
what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGA
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AA
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
The following is a section of a messenger RNA: 5' GACUACAUA 3' Look at the sequence carefully and using the following genetic code, translate the MRNA into an amino acid sequence. Second Letter U A G Phe uCu UC | Tyr UGU Cys u UUU U UUC UUA UUG UAU UAC UAA UAG UGC Stop UGA Stop A Stop UGG Trp G Ser UCA UCG Leu CAU CAC САА CAG CU CU His CGU U c Cuc CUA CUG Leu cc CCA CG CGC Arg CGA CG Pro Gin A 3rd G 1st letter AUU Ser u letter ACU lle ACC ACA AAU Asn AGU Thr AAC AAA A AUC AGC AUA AGA | Lys A Arg G AUG Met ACG AAG AGG Asp GUU G GUC GUA GCU GAU GAC GAA GGU GGC Gly Val |GCC GCA GCG Ala GGA GGG A Glu GUG GAG G O Tyr-Val-Val O Asp-Tyr-lle O Leu-Met-Tyr O lle-His-Gln O Asp-Thr-Leu-Tyr-Thr-His-lle 星
The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.
A mRNA sequence is shown below. Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine. 45 50 55 60 65 5’—A A C G A A U C G U C G C C A A C U A A G A G –-3’ Which of the following DNA mutations is almost certain to result in a shorter than normal protein? at position 56 a change from G to C an insertion of a G after the G at position 56 inversion of region 56-59 (G C C A) an delete the C at position 52 None of the above.
What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5' TEMPLATE STRAND 5' TAGCCAATTG 3' CODING STRAND 1. 5' AUCGGUUAAC 3' 2. 3' GUUAAGGCAU 5' 3. 3' GUUAACCGAU 5’ 4. 5' UAGCCUUAAC 3'