Which DNA sequence would base pair with the structure shown below? Thymine, Thymine O 5' GGCC 3¹ O 5' GCGC 3' O 5' ATAT 3" O 5' CGCG 3¹ O 5' GGCG 3' O 5' CCGG 3' O 5' GCGG 3' O 5' AATA 3¹ O 5' TATA 3' O 5' TATT 3' O 5' TTAT 3' O 5' ATAA 3' O=A- Adenine -O O=A O-P-O Adenine
Q: 4. Complete the following chart. ✓✓✓✓ Function Composed of (Elements) Bond Carbohydrates Glycosidic…
A: Biomolecules are the molecules that help to sustain the life of organisms. They vary in size and…
Q: Using proper convention, provide the amino acid sequence for the following peptide. O=C…
A: There are four classes of biological macromolecules- nucleic acids, proteins, lipids and…
Q: The SGLT transporter may be best described as a: a) symporter b) antiporter c) pump protein d)…
A: The objective of these questions is to test the understanding of various biochemical processes and…
Q: Which of the following would be present in the urine of dogs that were fed phenylpalmitate? (Note:…
A: Fatty acids primarily undergo oxidation in mammals via beta-oxidation. Beta oxidation is a cyclic…
Q: thymine nucleotides
A: Nucleic acids:These are long linear polymers that carry information that can be passed from one…
Q: The reaction in gluconeogenesis catalyzed by Glyceraldehyde-3-phosphate dehydrogenase (GADPH)…
A: Gluconeogenesis is the anabolic pathway that generates glucose from non-carbohydrate precursors like…
Q: what is biotins bond energy and bond lengths?
A: Biotin is also known by the name of vitamin B7. This vitamin is involved in a wide range of…
Q: Draw the structure of malibiose a sugar found in plants and answer the following question: a) What…
A: Melibiose is a disaccharide composed of two monosaccharide units: glucose and galactose. The linkage…
Q: Identify the structure of O-a-D-sorbopyranosyl-(2 → 4)-B-D-glucopyranose below. The following…
A: The disaccharide of interest here is . Pyranose indicates a 6 membered ring with 5 C and 1 O atom.…
Q: A)Label each sugar as D or L b. Label each sugar as a or B
A: Sugars are the generic names for sweet-tasting carbohydrates. Simple sugars are known as…
Q: M-CSA Mechanism and Catalytic Site Atlas (ebi.ac.uk) (ii) Acyl Carrier Protein S-acetyltransferase…
A: The FASN gene in humans codes for the enzyme fatty acid synthase (FAS). The multienzyme protein…
Q: Give the names of both non-polar amino acids shown in the image Complex I is Comples It is I COO- T…
A: There are four types of biological macromolecules: nucleic acids, proteins, lipids and…
Q: If the serine phoshorylated by Protein Kinase A (PKA) on phosphofructokinase-2 (PFK-2) were mutated…
A: Glucose levels in the blood are maintained by glycolysis (catabolism) and gluconeogenesis…
Q: Give the substrate for each of the following enzymes: A. Succinate Dehydrogenase_ B.…
A: The metabolic process known as glycolysis, which takes place in the cytosol, the liquid portion of…
Q: A patient has a defective liver FBPase-2 enzyme, the enzyme that converts F2,6P into F6P. This…
A: Fructose 2,6-BIsphosphate is a potent regulator of glycolysis and gluconeogenesis. It has a special…
Q: In mixed inhibition as shown below, please draw a lineweaver-burk plot when Kl is greater than KI'.…
A: Michalis Menten equation for given reactionE + S ESE+PVo - Initial velocity or initial reaction…
Q: Part A Why does it make biochemical sense that chaperones recognize hydrophobic surface area? What…
A: There are four classes of biological macromolecules- proteins, nucleic acid, lipids and…
Q: 13. What was the old-fashioned, traditional test to determine carbohydrate composition, which…
A: There are four classes of biological macromolecules: nucleic acid, proteins, lipids and…
Q: Identify which of the statements below is/are true regarding the "kinase" family of enzymes.…
A: Enzymes are the proteins that speed up chemical reactions in the biological system. Substrates are…
Q: Categorize each of the following carbohydrates as an aldopentose, aldohexose, or ketohexose. Drag…
A: Monosaccharides can be divided into aldoses and ketoses based on the functional group in…
Q: 2. Muscle physiologists study the accumulation of lactic acid during exercise. Food chemists study…
A: Solutions that are resistant to pH changes when added to, either an acid or a base, are known as…
Q: Carbohydrates: Draw the structures of the two products obtained when lactose is subjected to…
A: Lactose is a disaccharide composed of a and a . The C1 of forms a glycosidic bond with C4 of…
Q: Glucose 1-phosphate formed by glycogen degradation is converted to glucose 6-phosphate by…
A: Glycogen is a stored form of glucose and is reserve food material in animals. Glycogenolysis is a…
Q: The absorption spectra for three different amino acids, phenylalanine (Phe), tryptophan (Trp), and…
A: Molar absorptivity is a measure of how well a molecule absorbs a specific wavelength of light. The…
Q: As discussed in Lipids 3, SREBPs are a type of transcription factor involved in lipid homeostasis.…
A: The full form of SREBPs is Sterol regulatory element binding proteinsSREBPsare composed of two…
Q: You may change your response by submitting again. The reaction in gluconeogenesis catalyzed by…
A: Gluconeogenesis is the anabolic pathway in which Glucose Glucuronic a synthesised from non…
Q: You perform a size exclusion chromatography experiment and generate the following standard curve.…
A: In the question Kav vs molecular weight plot is given and the resulting linear equation is: y =…
Q: Short Answer: Page 5 of 5 Alcohol dehydrogenase catalyzes the oxidation of an alcohol to the next…
A: Methanol (CH3OH) is a toxic alcohol that is found in various household and industrial agents. The…
Q: If you discover that a protein binds more than one molecule (ligand). How can you determine whether…
A: Proteins are the large and complex biomolecules composed of a large number of amino acids attached…
Q: Which of the following has a phosphoanhydride bond? Select all that apply. n A of of най OH OH о B Ш…
A: Phosphoanhydride bond: the bond that is formed by the removal of water molecules between two…
Q: Explain why the use of the ATP analog below in the reaction catalyzed by pyruvate carboxylase might…
A: Chemical energy is transported and stored by ATP inside the cells. When the groups of phosphates…
Q: What is the relative activity of the following mineralocorticoid drugs? A. A>C>B>D B. A>B>C>D…
A: The general structure of mineralocorticoids is given below.Modifications to this structure can…
Q: Which of these is not a component of phosphatidylcholine? a) glycerol b) phosphate c) choline…
A: The objective of the question is to identify the component that is not part of the structure of…
Q: b. Write a paragraph or bullet point list to go along with the figure 11.8b describing the role of…
A: Standard change in Gibbs free energy ( ) of redox reactions can be found, if we know the standard…
Q: Lipids from an organic sample are extracted separately by column chromatography using the ff…
A: The objective of the question is to identify the possible lipids present in each eluate based on the…
Q: Explain this quesiton in descrition format whether non-barbiturate drug classes are labeled at a…
A: Non-barbiturates: Imagine a bunch of different keys, each one designed to fit into a specific (lock…
Q: What is the name of the process of the interconversion of the aldose and ketose forms of glucose ?…
A: There are four classes of biological macromolecules: nucleic acid, lipids, proteins and…
Q: B-mercaptoethanol is a reducing agent for disulfide bonds, resulting in the breakage of the…
A: Disulphide bond is a disuphide bridge between two cysteine residues which are in close proximity.…
Q: 19. Endorphins are polypeptides that reduce pain. What is the amino acid order for the following…
A: The body produces endorphins, which are neurotransmitters that can provide sensations of pleasure or…
Q: acetyl CoA
A: Acetyl CoA is a central metabolite that plays important roles in energy production as well as…
Q: 2. The structures of different coenzymes are given below. (A) Write the name of the coenzyme; (B)…
A: In biological systems, most of the reactions are catalyzed by enzymes which are proteins that help…
Q: Which of the following are effects of catalyst that cause an increase in the rate of reaction? (This…
A: The 'D' in DG and DG+ stands for delta ().DG () is the change in free energy. For a general reaction…
Q: chromatography
A: Hydrophobic interaction chromatography segregates molecules by their degree of hydrophobicity.The…
Q: What does -log(p-value) tell in immunoprecipitation mass spectrometry? What does log2 Fold change…
A: The question is asking about the interpretation of the -log(p-value) and log2 Fold Change in the…
Q: What is the role of FAD in the preparation of pyruvate to enter the citric acid cycle? to perform a…
A: The question is asking about the role of Flavin adenine dinucleotide (FAD) in the process of…
Q: Calculate kcat/KM for the enzyme reaction. Express your answer to two significant figures.
A: Kcat is the turnover number of an enzyme and it describes the number of product molecules formed by…
Q: c) If Jane Chemist wants Cysteine to move down the middle of the paper during electrophoresis, what…
A: There are four types of biological macromolecules: proteins, nucleic acid, lipids and…
Q: B. Carbohydrate Reaction D-Talose is a C2 epimer of D-galactose. Using the Fischer projection…
A: Kinases are enzymes that transfer a phosphate group from ATP to its substrate. A C3 kinase…
Q: at R #314 J K not
A: Catalytic efficiency of enzymatic reaction (turnover)For catalysed reaction the Kcat is used where…
Q: What was the old-fashioned, traditional test to determine carbohydrate composition, which resulted…
A: Carbohydrates are one of the 4 biomacromolecules. Their general structural formula is Cn(H2O)n and…
Please don't provide handwriting solution
Step by step
Solved in 3 steps with 4 images
- The complementary sequence for the strand given below is 5' AUU CCU CCC AAU AUG 3' O 5 CAUAUUGGGAGGAAU 3 O 5' UAAGGAGGGUUAUAC3' O 3' GUAUAACCCUCCUUA 5' O3' AUU CCU CCC AAU AUG 5'Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5' O 5' GCG TCA CCT GTA AAG 3' O 5' GAA ATG TCC ACT GCG 3' O 5' GCG UCA CCU GUA AAG 3' O 5' GAA AUG UCC ACU GCG 3'Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.Given Sequence: 3’-TACGGTCCGGATTCGGTAGCTAGCATC-5’ Provide: Complementary Strand: Transcript Amino Acid Sequence 2.Given Sequence: 5’-GGGCATATGCCGTTTACCGGTTTGACTAAATAACCA-3’ Provide: Complementary Strand: Transcript Amino Acid Sequence 3.Given Sequence: 3’-AAC CAA TAC GTG AGG ATA CCA AGT AAC ACT CCC-5’ Provide: Complementary Strand: Direct Transcript: Transcript for Translation: Amino Acid Sequence:Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
- Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphateBasisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…Which forward are reverse primers will amplify the following sequence by PCR? 5' GACCTCGCCGACGCCCTCGACCAGCTCCTGCGCCGCACCCGCCACCTCGCCGAGACC GAGCAGAAAACCCGCCGTCGGAGAGCCACCCGCTCCGGTACGGCAGCACAGTTGCCCGA TCTTCCAGGCCAGCGGCGCCCATTCGACGCAGAGACCGCACCGGCCCCGGCACCGGACT GGAGCGAGAGCCTGGACGACCTCATCAGCGTCGACACGGCGGCCCAGACCGGCACGAGC GAGATGGAGGGCGCGAGCGTGCCGCCGGCCGAGGCAGGCGGGTACGGGCTGTGGGACGC CGAAGCGGAAGCCGAGCAATGGTGAACGCCTCACCGGGCACGAGCGATACGCCGGG 3'
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives the following amino acid sequence: HPIAVRILS What triplet of nucleotides (in other words, what DNA codon) represents the amino acid "P" (proline)? a) 5' GTA 3' b) 5' CAT 3' c) 5' CCT 3' d) 5' ATC 3'Which primer would bind to this coding strand as a reverse primer? 5'- ATGGCCAAAT GATTCCCACG ATTTGGCCAT TGAGATCCGG - 3' O3'- ATGGCCAAAT - 5' O 5'- CCGGATCTCA - 3' O 5'- ATGCGCAGAT - 3' O3'- CCGGATCTCA - 5' N