Lab 11 Data Sheet

Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.

Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the segment of DNA: How many open reading frames (ORF) are in this sequence? How many amino acids are encoded in all open reading frames in this segment/sequence? Which strand is the template strand for the longest open reading frame?

Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH

Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that can beidentified rapidly by inverse _______

EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5'   Number of pieces of DNA , and type of fragment .

EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3

t (5 a 1 dao) - Google Chrome edu.om/mod/quiz/attempt.php?attempt=2334320&cmid=1127808 SQU E-LEARNING SYSTEM (ACAI الوقت المتبقي 0.175mm .e O In the DNA extraction experiment, the separation of DNA from its packaging protein can be achieved by the addition of Detergent aO 1.00 Salt b O هذا السؤال Ethyl alcohol cO Papain powder .d O Cold water Le O In paramecium, osmoregulation occurs through 3 Activate Windowssk Macronucleus Goaotings to acttivate do nere to search 6. 70°F Mostly sunny 9:05 ENG 12/18 f2 O f3 O f4 O f6 O f8 end f7 0 F10 insert f9 D F12 T num IA break @ %24 & 8 2 3 r 4 5 6 7 8 A 9 9 R Y ! U S F G J K +|| 回 Q 以 4

15

ersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ON

consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.

The following DNA sequences were used to generate a contig from a genome sequencing project. ttcagattttccccg gctaaagctccgaa gccattaacgcc tttagcatactacggcgtta aaaaccggggaaaat tccgaatcggtcattcaga How long is the fully assembled contig?

Aa Po AaBbCcDc AaBbCcDdEe AaBbCcDdE AaBbCcDdE AaBbCcDdE BIUVab x, x A ev A 三==|這、|の Caption Emphasis Heading 1 Heading 3 Heading 4 Style Pane (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: Fo DNA only (D) TA2G – Completed forms must be available for Open Awards external moderation purposes. Page 6 of 15 > T | RNA only (R) Both DNA and RNA (B) Statement D or R or B Contains thymine Contains ribose Consists of two chains connected to each other with hydrogen bonds Has a sugar-phosphate backbone Has four different nitrogenous bases Contains a pentose sugar Is found in the nucleus and cytoplasm English (United Kingdom) Focus 目民 2490 words +1

Ailee is interested to determine the nucleotide sequence of her bacterial heat shock gene. Hence, DNA sequencing needs to be performed for this analysis. One of the earliest methods invented is known as Sanger sequencing. Explain in detail the mechanism of this sequencing technique with the aid of a simple diagram.

DNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?

11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1

wol for Frayon Elolog - Meet - cha-gX-m sc Jupiter Ed G Which orgerell= A sample of DNA is collected from an organism. It is analyzed and determined that 20% of the DNA is made up of the base adenine. Based on this information, which of the following correctly lists the amounts of the three. remaining bases for this sample? 10% cytosine, 30% thymine, 40% guanine O 20% cytosine, 20% thymine, 20% guanine 30% cytosine, 30% thymine, 20% guanine 30% cytosine, 20% thymine, 30% guanine p. 5 of 31

please asap

There are numerous methods for sequencing DNA, including classical Sanger sequencing, automated Sanger sequencing, and next-generation sequencing technologies, including Illumina technology. Match the modified cytidine nucleotide triphosphates (NTPs) with DNA sequencing methods that utilize them. Classical Sanger sequencing HO-P=O O HO-P=O O HO-P=O O Automated Sanger sequencing -NH₂ CH3 H₂CN ° ? ?N HOOOO OH OH OH NH CH₂ Next-generation DNA sequencing (Illumina) CH₂ NH₂ Answer Bank

This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.

Do question 31

Please explain why the order is 3–1-4-2 and not another way, thank you so much. Question is in the image.

139. Subject  :- Chemistry

Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was subjected to pyrosequencing, sketch the expected profile of the sequencing output. Assume that the sequential flooding of nucleotides follows the order G-C-A-T.

4b

11. please answer, i'll give thumbs up

Computate bioinformatically the Tm value, the GC-content of the selected DNA sequence and the absolute nucleotide composition of the selected gene. Please provide also the tool source of the computation. Sickle Cell Anemia is the disease being used. Please answer the question using sickle cell anemia

The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'

11) Examine the following two DNA sequences. Sequence 1: ATGCGATGCTAGCAT Sequence 2: ATGCGATGATAGCAT If both of these sequences code for proteins, how might the function of protein 2 differ from the function of protein 1? Use the table below for assistance. U C A G บบน UUC UUA UUG CUU CUC CUA CUG U Phe GUUT GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or Start Val Ceweg 232 www... UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG C GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG A AAU AAC AAA AAG UAU U UAC C UAA Stop UGA Stop A UAG Stop UGG Trp G Tyr GAA GAG His Gin Asn Lys GAU GAC Asp G c] Glu UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Arg Ser Arg Gly U C A G U C A G U C A G by Calin me press A) Protein 1 and protein 2 will function exactly the same. B) Protein 1 will be shorter than protein 2, so they will not function the same. C) Protein 2 will be shorter than protein 1, so they will not function the same. D) Protein 2 has a different sequence, so it will function…

Can you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dna