LS7A Problem Solving Session 6 (Week 7)v3_Online_F20

practice problem genetics

problem36

Lesson 2 Focus Questions 1. What chemicals and molecules are needed for PCR, and what is the function of each component? 2. Examine the 150 base promoter sequence below. Kaylee Kauff 5'TAGAAAAGGA AGGTGGCTCC TACAAATGCC ATCATTGCGA TAAAGGAAAG GTATCATTC AAGATGCCTC TGCCGACAGT GGTCCCAAAG ATGGACCCCC ACCCACGAGG AGC ATCGTGG AAAAAGAAGA CGTTCCAACC ACGTCTTCAA3' Write in the sequence of the complementary strand and mark the 3' and 5' ends of the complementary strand. 43

L

Need help to answer the following questions. Not sure if my answers are right.

Problem #2 DNA TACT TAA A AAT G A (TS) DNA (CS) MRNA Amino Acids: Please continue to the next page. Activity 2- Reinforcing Protein Synthesis Use your codon chart to determine the amino acid sequence. Read through the strand and ONLY start on AUG and STOP when it tells you to stop. Follow example below: Example: DNA > AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA > UCU GCC AUG GAG GC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG protein > start - glu - ala -thre - hist – asp -glu – threo - stop 1. DNA → CCT CTT TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCCATA ATC MRNA protein > 2 DNA → AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA > pratein > 3. DNA > TAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTCGCC ATC MRNA > protein → 4. Fill in the diagram below. DNA MRNA ERNA Amino Acids Please continue to the next page. Universal Genete Code Chart Mensenger RNA Codans and the Amina Asd for Which They Code SECONDBASE…

Short questions

Practice test

Questions and situational problems I. A particular gene codes for a mature mRNA containing 900 bases, which is translated into a 40 kDa protein. A mutant form of the gene created by a single point mutation yields an 830-base mature mRNA yielding a 37 kDa protein with modified enzymatic activity. The analysis shows that the mutation has resulted in a 22 amino acid deletion within the protein. What is the most likely effect of the mutation? Explain.

Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG

Short questions

Genetics Need Help please!!

Need help with question one

Short questions

Please complete Task #2

I need help with a matching biology question: This is a single stranded molecule that in Eukaryotes passes from the nucleus to the cytoplasm. This makes up the ribosomal subunits and reads the mRNA. They carry amino acids during the process of translation. The structure is the site of translation. This is the enzyme complex that is used to copy DNA during transcription   matched with: ribosome mRNA rRNA tRNA RNA polymerase

Task 1: Compare the characteristics of DNA to RNA. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. DNA RNA No Answers Chosen No Answers Chosen DNA & RNA No Answers Chosen Possible answers Phosphate group | Cytosine Adenine Basic unit is the nucleotide Single strand Double helix E Phosphate-sugar backbone | Uracil | Guanine | Thymine :::: ::::

I need question 27

Practice Problem 1: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGG ACAAGATGGATATCATTAG 3 AGTTA C CCTCGTGGT CCTGTTCTACCTATAGTA 5' 3' Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.