Transcription Translation A17a (1)

Thx!

Do all

1 You will start with Transcription translation Sequence I. You are allowed two attempts 1 point Assemble the mRNA Transcription translation Sequence I. 546465-33-33-4448538854-266666668885-34-483- If this was an eukaryote, what would you find in the leftmost cytosine? 5' Poly A tail 3' Poly A tail 5' Cap 3' Cap 2 3 $ 4 er dº 5 6 7 8 9 0 + 11 Ne

DNA MANNMANN B) mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature mRNA b mRNA Cell membrane You are trying to explain to your classmate how DNA is used to make proteins. What should you include explanation? Select ALL that apply. During translation, the genetic code in mRNA is read and used to put amino acids in place to make a protein. During transcription, the genetic code in mRNA is read and used to put nucleotides in place to make a protein.

TRANSCRIPTION ein The DNA provided for your animal is one side of the double helix. DNA - MRNA 1. Transcribe the DNA strand into mRNA. Don't forget the special base pair ham AU rules for RNA! VERSION 2 TA Fuentes- 2. Translate the mRNA into an amino acid chain. Notice that this is broken into 1 i nucleotide sequences called CODONS. Use the codon chart to find the i correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G G C ity you Co deter y Fuentes- code DNA TAC TGG GGT GT C стс TAG CTA ATC TAC IG G AC G cCc ACC GGT ATG ΑΤΤ thousar ytakes And se MRNA d or create AA Turn in 1l tables DNA TAC CAT TAC C GT CCC TC G GT T AT C TAC AAC AGG CCT TT G GC T CCG ACT MRNA thesis nments AA to Sean Che comme DNA TAC TTG GT T CT C CT G тст ACA ACT TAC CAT CGA TTG GGG T G T TAG ATC S comm MRNA AA Decide if you want to illustrate a horse, coyote, or a cat - get the phenotype information from…

Please help me I am a bit confused

22

Do all

4

You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome

2:09 PM Sun Jan 22 RNA polymerase The following drawing represents simultaneous transcription and translation in E. coli. Answer the questions below the drawing. The arrow gives the direction of the RNA polymerase. (a) Is the letter A nearer the 5' or the 3' end of the molecule? (b) Is the letter B nearer the 5' or the 3' end of the molecule? (c) Is the letter C nearer the 5' or the 3' end of the tRNA molecule? (d) What is the "S" value for the large rRNA that is closest to the letter D? (e) Which terminus (N or C) of the growing polypeptide chain is nearer to the letter E? X₁ Direction of Exe ∞xxx ribosome 5' 3' E o uswonline.blackboard.com ●●● polypeptide chains The figures below serve as supplemental materials for the question. RNA polymerase RNA Coding strand 5'. Coding strand amino acid Template strand ATGATCT CGTAA RNA 5¹ AUG AUC → 3' ITITI B TACTAGAGCATT large subunit of ribosome 3' Template strand 3' 5⁰ Click Save and Submit to save and submit. Click Save All Answers to save…

Remember remove the introns! All introns start with GT and end with AG.

Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand is in the cytoplasm of a cell and translation is in progress. Draw and label all the necessary main players needed for translation to occur. Included in your drawing should also bee 3 tRNAs , these 3 tRNAs should represent two different forms of tRNA.   MRNA 5' ------------AUG------------AGG----------GAG

Help!

Mutated DNA Sequence #2: T  A  C  G  A  C  C  T  T  G  G  C  G  A  C  G  A  C  T  What’s the mRNA sequence? (Circle the change)   What will be the amino acid sequence?   Will there likely be effects?   What kind of mutation is this?

Do not use Ai

Mutated DNA Sequence #1: T  A  C  A  C  C  T  T  G  G  G  A  C  G  A  C  T  What will be the corresponding mRNA sequence?   What will be the amino acid sequence?   Will there likely be effects?   What kind of mutation is this?

RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…

Both answer please

Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G

pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:

6c and 6d

Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translation

Multiple choice A. The role of tRNA in translation is to be translated by a ribosome. incorporate into a polypeptide chain. attach amino acids to a polypeptide chain. carry amino acids to the ribosome.   Multiple choice B.  Translation continues until the ribosome falls off the end of the RNA. the ribosome encounters a transcriptional termination site. the ribosome encounters a stop codon. the ribosome falls off the DNA.

fill in the bubbles

Please hand written not allowed.

Sources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the amino acid triplet code CTA, what would the resulting amino acid be? 3. What is the complementary DNA code for the following base sequence (from a section of DNA)? ATG C C C G G C CT TATTTTCTACA TGGT b. What is the complementary mRNA code? c. What is the tRNA code for this sequence? ACTT

Follow instructions fill out 2nd row circle stop codons

Add-ons Help Last edit was 4 minutes ago Times New.. - BIUA 11 + Using the table the other page- transcribe the RNA sequence int codons and their amino acids: CAU TTG TAU UTA AAA TGG GCG Translation Mechanics Now that you are an expert code breaker, we can start to talk about thanslation. Let's go over the key players in the process. MRNA. The mRNA is the code that is translated into a functional protein. It is created through transcription and a series of subsequent editing steps, which we have described in detail already. The mature mRNA comprises codons that will code for the production of a protein. lili 日

i struggled with my homework and i need help

6. What codons ar e found in the mRNA for the two mutated DNA?