bioinformatics_notes

.pdf

School

California Polytechnic State University, San Luis Obispo *

*We aren’t endorsed by this school

Course

213

Subject

Biology

Date

Oct 30, 2023

Type

pdf

Pages

Uploaded by DukeLion3242

ENGR 213 Bioengineering Fundamentals A very coarse introduction to bioinformatics In this exercise, you will get a quick primer on how DNA is used to manufacture proteins. You will learn a little bit about how the building blocks of these proteins may change due to point mutations. And, you will investigate how a statistical description of these mutations can be used as evidence supporting hypothesized evolutionary paths. Summary of genetic machinery DNA sequences are composed of four bases: adenine (A), thymine (T), guanine (G), and cytosine (C). The two strands of DNA are composed of nucleotides with complementary bases where A is matched up with T and C is matched up with G. An example of the two strands of a fragment of DNA is shown here: DNA (3' end) ...CACCTACGTTCAGGAGGTCAGGACTGGTAC... (5' end) (5' end) ...GTGGATGCAAGTCCTCCAGTCCTGACCATG... (3' end) A DNA sequence is transcribed into mRNA starting at the 3' end of the DNA strand. Each nucleotide of the DNA strand attracts its complementary RNA base through a pairing rule. mRNA is composed of A, G, and C bases with uracine (U) substituted for thymine. The pairing rule is shown below: DNA -> mRNA A U T A G C C G DNA (3' end) ...CACCTACGTTCAGGAGGTCAGGACTGGTAC... (5' end) mRNA (5' end) ...GUGGAUGCAAGUCCUCCAGUCCUGACCAUG... (3' end) mRNA is translated into a sequence of amino acids by ribosomes. This process is initiated by a ribosome with the amino acid methionine attached to it. This ribosome latches onto the 5' end of the mRNA strand and begins to move downstream until it finds a sequence of three nucleotides, AUG, known as the start codon. This codon triggers the ribosome to start building a polypeptide with methionine as the first amino acid in the chain. The ribosome continues down the mRNA strand by binding to the next triplet (without re-using any of the mRNA nucleotides and matching each subsequent triplet with a particular amino acid. This continues until the ribosome reaches a “stop” codon signifying the end of the chain of amino acids which make up the particular protein coded by this genetic sequence. The triplets and their corresponding amino acids are displayed in the matrix on the following page.

ENGR 213 Bioengineering Fundamentals An alternate way of visualizing this information is the codon wheel:

ENGR 213 Bioengineering Fundamentals The red letters in the codon wheel are a simple code for each of the twenty amino acids that can be used to express the sequence of amino acids that comprise a single protein. The ribosome finds the beginning of the gene by looking for a start codon and then reads the mRNA sequence as a series of triplets until it reaches a stop codon. start codon v mRNA (5' end) GUGG AUGCAAGUCCUCCAGUCCUGA CCAUG (3' end) mRNA triplets AUG CAA GUC CUC CAG UCC UGA (start) (stop) Amino acids M Q V L Q S Notice that the codon table (or wheel) shows that there are two different mRNA codes for glutamine (Q) which differ in the third base of the triplet. Either CAG or CAA triplets will cause a glutamine to be added to the polypeptide chain. There is redundancy in the codon for some amino acids but there is no ambiguity. Redundancy is actually a trait which protects the genetic code from some point mutations. A point mutation is characterized by the accidental substitution of a single nucleotide with another nucleotide. A point mutation is responsible for sickle cell disease due to the substitution of a T for an A in a triplet for GAG. The sequence GAG codes for glutamic acid whereas the sequence GTG codes for valine. The substitution of one amino acid for another can cause the resulting protein to have a different shape and/or functionality. Point mutations that occur in the third base position are sometimes “silent” when they change the genetic code but do not change the sequence of amino acids in the resulting protein. Point mutations in the first and second positions are much more likely to change the structure of a protein. Important: The translation of mRNA does not begin before the Start codon, AUG. If you are asked to translate mRNA into a sequence of amino acids, you should always begin translating at the start codon and not before.

ENGR 213 Bioengineering Fundamentals Properties of amino acids This Venn diagram relates some of the properties of amino acids. Substitutions of amino acids with similar properties are less likely to change the function of the protein than those whose properties are very different.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version