MMBIO essay

.docx

School

Brigham Young University *

*We aren’t endorsed by this school

Course

221

Subject

Biology

Date

Dec 6, 2023

Type

docx

Pages

Uploaded by DeanIron8170

Braydon Ordyna Section 5 11/21/2023 Protein Folding Protein folding begins inside of the cell nucleus where the genetic material is located. DNA is then transcribed into complementary RNA molecules in a process called transcription. “Transcription begins with the opening and unwinding of a small portion of the DNA double helix to expose the bases on each DNA strand. One of the two strands of the DNA double helix then acts as a template for the synthesis of an RNA molecule.” (Alberts B) Transcription is broken down into three primary steps including initiation, elongation, and termination. Initiation begins when an RNA polymerase binds onto a specific region of the DNA called a promoter. The promoter is what signals the beginning of transcription. Elongation is the movement of the RNA polymerase along the DNA template strand. This movement is what synthesizes a complementary RNA molecule. The polymerase, as it moves along, adds nucleotides one at a time like a puzzle. “Elongation ends when the [elongation complex] dissociates in response to a specific termination signal.” (Nudler E.) This signal causes the release of the RNA molecule. This molecule of RNA is called messenger RNA, and it is what carries the genetic code out of the nucleus into the cytoplasm. Messenger RNA, or mRNA, then undergoes a process called translation. This process is what creates the protein. Like transcription, this process also includes steps such as initiation, elongation, and termination, but there is an extra step called translocation before termination happens. Translation happens in the cytoplasm with the help of an organelle called a ribosome. “The ribosome is universally responsible for synthesizing proteins by translating the genetic code transcribed in mRNA into an amino acid sequence. Ribosomes use cellular accessory proteins, soluble transfer RNAs, and metabolic energy to accomplish the initiation, elongation, and termination of peptide synthesis.” (Vanzi F.) In the initiation step, this ribosomal unit binds to the mRNA. The mRNA is set up in triplets that code for different amino acids called codons. Initiation always begins with the start codon of AUG. From here, elongation begins by moving along the mRNA and adding in the proper amino acids for each codon. The ribosome catalyzes the formation of a peptide bond between the amino acids as it moves along. Translocation is the repeated process of the ribosome binding and moving down the mRNA. Termination occurs when a stop codon is detected by the ribosome which may include, UAA, UAG, or UGA codons. At this point, a release factor binds to the ribosome and causes the completed protein to be released. This newly synthesized polypeptide chain may undergo various modifications, including folding into its three-dimensional structure. Chaperone proteins assist in this folding process. “It is important to note that chaperones do not convey additional information required for the folding of polypeptides into their correct three-dimensional conformations; the folded conformation of a protein is determined solely by its amino acid sequence. Rather, chaperones catalyze protein folding by assisting the self-assembly process.” (Cooper GM) The fact that the protein knows precisely how to fold is truly remarkable. As Christopher M. Dobson put it, “The [way] a newly synthesized chain of amino acids transforms itself into a perfectly folded protein depends both on the intrinsic properties of the amino-acid sequence and on multiple contributing

influences from the crowded cellular milieu. Folding and unfolding are crucial ways of regulating biological activity and targeting proteins to different cellular locations. Aggregation of misfolded proteins that escape the cellular quality-control mechanisms is a common feature of a wide range of highly debilitating and increasingly prevalent diseases.” It is crucial that these newly formed proteins fold in the proper way. We learned in class that when a protein is folded in a slightly different way, it can have catastrophic effects. One example was Creutzfeldt-Jakob disease. This disease is caused by an abnormally folded protein in the brain that causes the nervous system to begin to deteriorate. There is no cure, and you will die from it. Improper protein folding is a scary thing, and I am grateful that our body has ways to ensure that this doesn’t happen spontaneously. Studying and understanding the intricacies of transcription, translation, and the importance of properly folding proteins has helped to open my eyes to the greater understanding that my Heavenly Father is the God of order and not the God of chaos. Every piece and every step of the process has its role in making the final product perfectly suited for the function it needs to play. The polypeptide chains are designed to fold correctly, ribosomes know what to look for on the mRNA, and the RNA polymerases know when to start and stop transcription. There are so many different places in this process that could have problems arise, but for the most part, this process works just about everywhere. Our Heavenly Father has designed a process capable of sustaining His children as well as His other creations. My testimony has certainly grown through learning more in-depth information about the human body. There are far too many things that point to a divine Creator. The intricacies and principles found in the processes can be broken down into separate parts that all function together in harmony. It’s beautiful! From the way the cell divides, to the way the cell “eats,” and even how the cells grow and develop. Being mindful of all these things does not form the basis of my testimony, as it shouldn’t for anyone else either, but it certainly can bring about spiritual experiences of confirmation that we have a loving Heavenly Father. He is there and He wants us to succeed. The proof that He wants us to continue to make decisions for ourselves so we can become like Him is in the very bodies that He made for us. Moses 2 verses 26 & 27 says, “And I, God, said unto mine Only Begotten, which was with me from the beginning: Let us make man in our image, after our likeness; and it was so. And I, God, said: Let them have dominion over the fishes of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth. And I, God, created man in mine own image, in the image of mine Only Begotten created I him; male and female created I them.” Our Heavenly Father is the most complex, sophisticated, and knowledgeable being in the universe. It’s only logical that His creations reflect that complexity. Proper protein folding is just one of many ways that divine knowledge can be seen. I am truly grateful for the wonderful body that was made for me and for the processes that continue to happen in my body to keep me alive. I am thankful for the opportunity to be on this Earth and to be able to choose how I live my life and to learn from those experiences. Heavenly Father is real, and He truly does love each of His children.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

Related Questions

Read instrxutions and complete MRNA CODON TABLE.

Protein 2: DNA AGAGTTCTGCCCTGTCGATTT MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?

AKS 5c1: Which explanation accurately describes the model below? * DNA MRNA Transcription Mature MRNA Nucleus Transport to cytoplasm for protein synthesis (ranstation MANA Cell membrane This model represents protein synthesis since the tRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because MRNA is coiling to form a new protein molecule in the cytoplasm.

Please help answer b)

DNA MANNMANN B) mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature mRNA b mRNA Cell membrane You are trying to explain to your classmate how DNA is used to make proteins. What should you include explanation? Select ALL that apply. During translation, the genetic code in mRNA is read and used to put amino acids in place to make a protein. During transcription, the genetic code in mRNA is read and used to put nucleotides in place to make a protein.

Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.

Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?

-66 The following sequence of the DNA template strand contains: 5'AGGCTCCAGG 3' out of Which complementary RNA strand can be made from this sequence? uestion Select one: O a. 5' UCACAGGUCU 3" O b. 5' UCCGAGGUCU 3" O c.5' CCUGGAGCCU 3' O d. 5' UGGCTCCUGC 3' e. 5' GACCTCGGAA 3"

Match the process to the related enzyme/structure in Bacteria. translation [Choose ] [Choose ] DNA replication helicase ribosome transcription DNA polymerase ligase reverse transcriptase RNA polymerase Question 46

Plssssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include the following terms in your description: -DNA - mRNA -protein -tRNA -Amino acid -codon -nucleus -Ribosome -cytoplasm -transcription -translation

Direction: Please answer letter B and email C thoroughly and explain your answer. Thank you so much.

Match the molecule with its correct description

At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, FRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. MRNA FRNA tRNA MRNA, FRNA, and tRNA Answer Bank contains nucleotide triplets that code for specific amino acids acts as an enzyme for peptide synthesis has a convoluted structure with a three-base sequence called an anticodon moves amino acids to the site of protein synthesis in eukaryotes, can exist outside the nucleus moves genetic information out of the nucleus and into the cytoplasm composed of ribonucleic acid

Help please (40)

SPLIT DNA MRNA TRNA Codon Anticodon Amino Acid A T C A T T A T C T A G A

Decide whether the statement is TRUE OR FALSE. Justify your answer. Introns are coding regions of the DNA that becomes part of the mature mRNA after splicing. A eukaryotic gene can be expressed without undergoing transcription. Eukaryotic translation occur in the cytoplasm. The newly synthesized DNA strand during replication was made from the 5’ to 3’ direction. The enzyme helicase unzips a double-stranded DNA by breaking the ionic bond between base pairs.

a. 0.02z3 ML Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis? 1-ribosome bonds amino acids together; 2-MRNA leaves the nucleus; 3- TRNA molecules pick up amino acids; 4-DNA double helix unwinds; 5-TRNA anticodon links with mRNÁ codon; 6-polypeptide chain completed; 7-MRNA binds to ribosome; 8-mRNA transcibed Select one: a. 6-5-7-3-2-1-8-4 b. 4-2-8-3-7-5-1-6 c. 1-8-6-7-5-3-4-2 d. 4-8-2-7-3-5-1-6 e. 1-2-3-4-5-6-7-8 When using the high power objective, you should not adjust the Select one:

BONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA

Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________

Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

#18,21,24

38/ 50 Translation reques A mRNA tRNA, and rRNA 8 mRNA DNA and rRNA C. mRNA, IRNA, DNA, and rRNA D mRNA IRNA, and DNA E mRNA tRNA, DNA, RNA and a a

Number 7

Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.

Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp

A.C. 3.4 Q1. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC First base (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working. U U UUU Phenyl- UCU UUC alanine F UCC UCA -Leucine Lucc UUG-Le G CUU CUC CUA CUG A AUA -Leucine L AUU I AUC Isoleucine Methionine start codon AUG MMet GUUT GUC GUA GUG -Valine V CCU CCC CCA CCG ACU ACC ACA ACG C GCUT GCC GCA GCG Second base -Serine S -Proline P -Threonine -Alanine UAUT UAC A UAA UAG CAU CAC CAA CAG A Tyrosine Y Stop codon Stop codon -Histidine H -Glutamine AAA TAAG-Lysine AAC-Asparagine N GAU Aspartic GAC acid D GAG Glutamic G UGU-Cysteine C E UGC UGA UGG AGU AGC KAGG-Arginine CGUT CGC CGA CGG GGUT GGC GGA GGGJ Stop codon A Tryptophan -Arginine R Serine S R Glycine UCAG G SCAG SCAQ SCAG Third base

5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene

otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. Submit

Given the amino acid chain below, get the (a) translation strand, (b) transcription strand strand, and (c) DNA strand.MET-THR-THR-PRO-CYS-THR-TYR-THR-GLY-ASP-LEU-THR-GLY-MET-ILE-LEU-THR-ILE-ARG-PRO-ILE-LEU-ILE-STOPORIGINAL WORK PLEASE

SEE MORE QUESTIONS

Recommended textbooks for you

Anatomy & Physiology

Biology

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:OpenStax College

SEE MORE TEXTBOOKS