Quiz Results: Got Lactase? The Co-Evolution of Genes and Culture: HHMI BioInteractive

Please answer all questions GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homolog).10. Generate a secondary structure prediction for one identified protein.

what carries genetic information

please answer for all three questions  asap  all three questions are related

The questions are on the image.

Can you please answer this question 40

ME History Bookmarks Profiles Tab Window Help ucture.com/courses/47420/quizzes/225324/take Question 3. Choose the best method (from lectures 19-21) for each of the following experiments. You want to determine the transcriptomic response to heat shock in [ Choose ] a normal cell line. You'want to measure the quantity of mRNA of your gene of interest in sepal vs petal cells. [ Choose ] You want to identify the mutation that has occurred in your gene o V [ Choose ] interest after EMS mutagenesis. CRISPR Map based sequencing or whole genome shotgun sequencing You want to know the DNA sequence of all of the genes in a Recombinant DNA genome. Restriction enzyme digest RT-PCR or qPCR You want to make large quantities of DNA of your gene of interest from a tiny amount of DNA. Sanger sequencing PCR You want to determine the differences between the proteins made Cloning in the sepal vs petal cells. Microarray or RNA-seq Proteomics Question 12

please answer and explain 1 and 2

Please help me with this question immediately

Question is attached

Tn Midterm test Fall 2020 (page 2 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D6971498page=1 SQU E-leaning System (Academic) Question 21 The direction of mRNA molecule synthesis is .: Not yet answered Select one: Marked out of O a. From DNA strand that starts with 5' 1.00 O b. In the direction of 3' to 5 P Flag question O c. From DNA strand that starts with 3' O d. From RNA strand that starts with 3' O e. From RNA strand that starts with 5' Question 22 Which of the following organelles do plants and animals have in common? Not yet answered Select one: Marked out of O a. mitochondria, ribosome, nucleus, cell membrane, cytoplasm 1.00 O b. mitochondria, vacuole, nucleus, cell membrane, cell wall F Flag question O c. mitochondria, vacuole, nucleus, cell membrane, centrioles O d. mitochondria, vacuole, nucleus, cell membrane, cell wall, chloroplasts O e. mitochondria, vacuole, nucleus, cytoplasm, cell wall, lysosome

Please answer asap and type your answer and do not copy from anywhere please

Can you help ?

Explain the image. How does the results of electrophoresis must be read?

Number 7 please

D Question 9 An enzyme assay of 2 mL of extract shows 7.3 U/mL and a biuret assay shows 4 mg/mL protein on the initial sample. It is salted out and the pellet is washed and resuspended in 0.4 mL buffer. It is re-assayed and shows 12.1 U/mL activity and 1.3 mg/mL protein. What is the change in fold purity for this sample? (answer to 2 decimal places)

What is/are the independent variable/s? What is the dependent variable? What is/are the control/s?

ty of Indianapolis : 20202 X ace.uindy.edu/portal/site/202020-BIOL-104-07/tool/2e4f1021-614d-4fae-83d6-ff99ca3767e0/jsf/delivery/beginTakingAssessment M Gmail YouTube Maps A ApneTV Home of H... What is the first step in protein synthesis? O A. making an RNA copy of the DNA within the nucleus B. making a sequence of amino acids O C. forming peptide bonds between amino acids OD. making a copy of RNA with DNA outside the nucleus Reset Selection

Can you please answer questions 1,2 and 3

Please answer only questions 5-10, thank you GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL…

Hi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…

Content X Content ✗ Ontariol × Content X Enteric- ChatGP × G Intrader × W Cold An X G The grad × + ☑ ← >> https://ontariolearn.blackboard.com/ultra/courses/_30758_1/cl/outline?legacyUrl=~2Fwebapps~2Fblackboard~2Fcontent~2Flaunch...✰ S Relaunch to update : M Gmail ►▸ YouTube Maps Sign in | Permanent... Search Results login... G My Grammarly - Gr... York Region Childre... Applications Home | bartleby (50,482 unread) - a... E อ Priva Tern Acce Remaining Time: 04 minutes, 52 seconds. * Question Completion Status: Ferrous gluconate is used as an iron supplement to treat and prevent iron-deficiency anemia. This medication is available with a strength of 300 mg per tablet. Your patient has been prescribed a dose of 0.45 g. Which of the following configurations will yield the correct answer to the dosage calculation? ○ 0.45 g 1 1 tab ✗ ✗ 300 mg 1000 mg 1 g 0.45 g 1 tab 1 g ✗ ✗ 1 300 mg 1000 mg 1 1 tab 1 g ✗ 0.45 g 300 mg 1000 mg ○ 0.45 g 1 300 mg 1 tab 1000 mg 1 g Click Save and Submit to save…

d/e/1FAIpQLSfTle9UfP15_VUqFI-ACEQd1XBykXv5Lr4dEMQbLJ1d6fCupw/viewform Students subjected three samples of five different molecules to gel electrophoresis as shown in Figure 1 A B C DE +2 3 Wells 4 8. Which of the following statements best explains the pattern seen on the * gel with regard to the size and charge of molecules A and B? 1 point molecules A and B are positively charged, and molecule A is smaller than molecule B. molecules A and B are positively charged, and molecule A is larger than molecule B. molecules A and B are negatively charged, and molecule A is smaller than molecule B. molecules A and B are negatively charged, and molecule A is larger than molecule B. Sign out

esting 8MU376MpwkNtkrF5%252B26BVPP%252Bzg%253D%2. Question Image 1 3 6. 7. 8. with the figure? cracteristics ight differe dividuals can compared Q. Which of following can you do with the biotechnology depicted in the figure? • 0 1:47 Sign out || O|| | 11

Answer number 2, 4 and 5 pls.

FINALLLY FRIDAY Part B: How Mutations Can Lead to Disorders Note: The examples given in this octivity do not represent exact DNA sequences on the genes described. To do so would be impossible as most genes contain over 1000 nucleotides that code for several hundred omino acids which are joined together to form proteins. This activity gives small segments of DNA in each of these genes and DOES demonstrate actual mutations that do occur within them. Gene 1. Beta Hemoglobin Gene (HBB Gene) is an important gene located on human chromosome 11 shown below. This gene plays an important role in the production of hemoglobin, a protein in red blood cells responsible for carrying oxygen in your blood. Part A: Normal Beta Hemoglobin: Using the un-mutated DNA sequence supplied from the HBB gene below, transcribe and translate the DNA into the corresponding arnino ack sequence that forms hemoglobin. NORMAL H866 GENE MUTATED HBB GENE DNA RNA DNA RNA H 1 C C 2 3 11 S 2 3 Chromosome 11 6 7 56 TGAGCT 03…

Please help me with this question immediately please help????

I still do not understand how he got 17 minutes  I need it step by step and how to input it into the calculator to get the answer

I would like you to solve question 12.

Crossword Puzzle

fueled.brightspace.com/d2l/le/enhancedSequenceViewer/3300467?url=https%3A%2F%2Ff59af8a9-95f5-419c-a486-a A rdschools.com bookmarks Drive Classes B Login Page Sign In Education and Lear... Content = 1.08 Unit Test: Gene Expression - Part 1 Which statement is most accurate? Hair is different from kidneys because the cells that make up hair and kidneys have different genes All cells have the same genes, but different genes are active in different cells. As cells and tissues differentiate, they produce new genes. All cells have the same genes, and all of a cell's genes are active at the same time. #m C $ J лае 1 2 3 4 5 & 7 8

Hi please can I have the solution to the 4 question only. An explanation to the diagram will also be appreciated.

Content × Content / Ana ☑ OntarioLearn × Content × Furosemide is ☑ ChatGPT × G Intradermal in × + ☑ ← >> https://ontariolearn.blackboard.com/ultra/courses/_30758_1/cl/outline?legacyUrl=~2Fwebapps~2Fblackboard~2Fcontent~2Flaunch...✰ S Relaunch to update : M Gmail ►▸ YouTube Maps Sign in | Permanent... Search Results login... GMy Grammarly - Gr... York Region Childre... Applications Home | bartleby (50,482 unread) - a... Remaining Time: 13 minutes, 18 seconds. * Question Completion Status: 1 points ✓ Saved QUESTION 6 Furosemide is a loop diuretic used in the treatment of edema and hypertension. It is available with a strength of 20 mg/tab. A prescriber has ordered a daily dose of 40 mg. Which of the following configurations will yield the correct answer to the dosage calculation? 40mg 1 20 mg ✗ 1 tab ○ 40mg 1 tab 1 20 mg E 1 1 tab ✗ 40mg 20 mg อ 1 40mg 20 mg ✗ 1 tab Priva Tern Acce 1 Click Save and Submit to save and submit. Click Save All Answers to save all answers. Q Search myhp W…

Please explain how to get answer

1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8

will UPVOTE Kindly answer the question. 1. Do you think free amino acids will give a positive result with the biuret test? Explain why.

TOPIC: E. coli T4 (T4 Bacteriophage) Include a maximum of 3 sentences, a brief description of their growth. What are the structures responsible for growth and reproduction? What are their physical and nutritional (or chemical) requirements?