Chapter12ReviewquestionsWordfile

MULTIPLE CHOICE 1. What enzyme that function for cutting a DNA? A. Nuclease B. Ligase C. Primase D. Isomerase 2. Which of the following does not involved in the proofreading and repair of DNA? A. Isomerase B. Ligase C. DNA Polymerase I D. Nuclease

Multiple choice 1.) An Action potential A. is essential for nerve impulse propagation B. involves the influx of negative ions to depolarize the membrane C. involves the outflux of negative lons to depolarize the membrane D. Involves the outflux of positive ions to depolarize the membrane 2.) Which function can be carried out by DNA replication proteins? A. Topoisomerases wind the DNA into a double-helix. B. DNA ligase can initiate new DNA chains C. SSB converts double-stranded DNA into single-stranded DNA. D. Helicases break hydrogen bonds in the DNA. 3.) Which mechanism contributes to accuracy during DNA replication? A. The mismatch repair system recognizes an incorrect base-pair and corrects the mistake in the non-methylated strand. B. Using primers increases accuracy because the first nucleotides in a new nucleic acid chain are more likely to be correct. C. All DNA polymerases have a 5'-3' exonuclease activity which can remove incorrect nucleotides during…

Please answer fast 1. which of the following statements is true of no -homologous end joining?   a. it's error free b. it's a double strand repair pathway c. it requires RNA Polymerase d. it utilizes the sister chromatid as a template for repair   2. lab technique used to see how many different places a specfic probe would bind to the DNA in an organism genome.   a. southern blot b. western blot c. situ hybridization d. reverse transcriptase qPCR

2. Multiple choice

1. Describe the process of autophosphorlyation 2. Differentiate between chromosomes and genes. 3. Think about what happens at the replication fork. If the gene for helicase is mutated, what part of replication will be affected and how? 4. There are three common types of chemical changes that can damage DNA at any time post-replicatively. In basic terms, name and describe any two of the three types of damage.    please help me quick

Section B: True / False 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG 2. Telomerase possesses RNA polymerase activity. T or F 3. Topoisomerase binds to DNA ahead of the replication fork. T or F snRNA is not transcribed during translation. T or F 5. Promoter is located in the intron of pre-mRNA. T or F Poly-A tail is added to RNA in bacteria. T or F Translation stops when Stop codon arrives E site in ribosome. T or F EF-G is used in translation termination. T or F 9. A subunit of hemoglobin carries more oxygen molecule than a myoglobin does. T or F 10. The formation of carbamate group in hemoglobin reduces its affinity to oxygen. T or F 4. 6. 7. 8.

III. DOUBLE MATCHING TYPE choose the enzyme/protein/requirement in Column A, and the processes/stages where it occurs in COLUMN B. Column A Column B Enzyme/Proteins/ Requirements Processes/Stages A. RNA polymerase B. DNA polymerase I C. DNA polymerase III D. Single strand binding protein E. Sigma factor F. Ligase G. Peptidyl transferase L Replication initiation i. Replication elongation iI. Transcription initiation iv. Transcription elongation v. Transcription termination vi. Activation of amino acids vii. Translation initiation viii. Translation elongation ix. Translation termination H. Primers I. Aminoacyl synthetase J. Gyrase K. Release factors L Rho factor M. AUG-fmet N. Initiation factors

a. Pfu Polymerase  b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5.  Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chains

7. The scientist(s) who studied the transfer of DNA from one bacterium to another was (were): A. James Watson B. Rosalind Franklin C. Meselson and Stahl D. Griffith 8. Rosalind Franklin became famous for the study of: A. Replication mechanisms of the DNA B. Gene transcription C. DNA structure D. mRNA splicing 9. Which of the following is not required for DNA replication? A. DNA polymerase B. Single-strand binding protein C. Sigma factor D. Primase

Genetics Question

Part 4. Putting It Together 1) Consider the diagram below as well as the given information. This diagram represents a piece of circular DNA which was cut in 4 separate reactions (4 different test tubes, each with some of this DNA in it). One digest was done with AvaI, another with ClaI, a third with EcoRV, and a fourth with ScaI. The locations of the recognition sequences for each restriction enzyme are shown along with the location of that site in bp along the circle (it goes clockwise from position 1). You run an agarose gel with a molecular weight marker in the first lane, the AvaI digest in lane 2, the ClaI digest in lane 3, the EcoRV digest in lane 4, and the ScaI digest in lane 5.   a) Use the space below and draw out the agarose gel described above. Use your drawing to answer the next questions. b) How many bands of DNA are there in lane 3?   c) How many bands of DNA are there in lane 5?   d) There would be 2 bands of DNA in lane 4. How big are they?   e) Which lane…

11. please fill in the blanks

3) Why are single strand binding proteins (ssb proteins) needed in DNA replication? (note that you need to explain WHY ssb proteins are important, not just what they do)

Multiple Choice 1. Which of the following statement is considered false during DNA replication? A. The replication process undergone in the cytoplasm of prokaryotes. B. The replication process goes on 3’ ->5’ end. C. The replication process goes on 5’ ->3’ end. D. The replication process undergone in the nucleus of eukaryotes. 2. Which of the following statements best describes the relationship between the nucleotide sequences of the template strand and the non-template strand in the DNA of a gene? A. They are parallel to each other. B. They are complementary to each other. C. They are identical to each other. D. They are covalently attached to each other.

Part 2. PCR 1) In one color, write out the forward primer (5’ GATAC 3’) in the correct position relative to the given template DNA sequence.  In a second color, act as the polymerase and fill in the rest of the new strand of DNA       Primer/New Strand Template DNA:               3’ TAGCTATGCGGACCTCATGCATTAGAGTAG 5’   Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions   5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’   a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest?     b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect?   2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and…

Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions   5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’   a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest?     b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect?   2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a)  HpaI, recognizes 5’ GTT – AAC 3’   5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’   Number of fragments of DNA:…

Multiple Choice 1. Which is the correct amino acids using the anticodon strand of GCA-UCC-GCU? A. ARG-ARG-ARG B. VAL-VAL-PRO C. MET-TYR-HIS D. PRO-ARG-VAL 2. Which is the correct pair of DNA with a strand of 3’-TTT-GGG-AAA-5’? A 5’-AAA-CCC-TTT-3’ B. 3’-AAA-CCC-TTT-5’ C. 5’-TTT-CCC-AAA-3’ D. 3’-TTT-CCC-AAA-5’

ANSWER THE FF. QUESTIONS CHOOSE THE BEST ANSWER

Match the following.

1

This is an absolute stumper. Would you be able to assist with drawing and labeling would look like in this scenario?

1. For each of the items below, give a brief description (indicate function for enzymes) and indicate in which process (replication, transcription, or translation) it is involved with. Description/Funetion catalyzes the unwinding of DNA strands Process involved in helicase replication 1. RNA primer 2. leading strand 3. RNASE 4. anti-sense strand 5. anticodon. 6. RNA polymerase II 7. DNA polymerase 8. promoter site 9. DNA ligase 10. exit site 11. terminator 12, ribosome 13. amino-acyl 1RNA site 14. MRNA 15. tRNA 16. RNA 17. Shine-Dalgarno sequence 18. start codon 19. Okazaki fragments 20. coding strand 21. peptidyl tRNA site

Answer both plz.