hw3

Answer the auestions below. Thank you.

I-Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600.  Give the expected sizes of the restriction fragments following complete digestion.

B. Restriction Mapping. Single and double digestion of plasmid pMCS326 were performed using the restriction enzymes Alulll and EcoRV. DNA fragments are shown in an electrophoretogram below. Construct a restriction map of plasmid pMCS326 for enzymes Alulll and EcoRV. 20 kb 11 kb 8 kb 6 kb kb 3 Alulll + Alull EcoRV ECORV | || Restriction Map:

PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |

Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI

I'm asking provide handwritten solution with right answer. Provide right answer

A Moving to the next question prevents changes to this answer. Question 1 Which step is NOT included in the technique called Southern blotting? O a. visualization by autoradiography or fluorescence imaging Ob. exposure to a 32p-labeled DNA probe Oc amplification of the restriction fragment-probe duplex d. hybridization of the probe with a restriction fragment having a complementary sequence Oe transfer of the mixture of restriction fragments into a membrane composed of nitrocellulose &Moving to the next question prevents changes to this answer. MacBook Pro esc Q Search Secure Search %23 2 & LO % 4

please answer and explain thoroughly!!!

please help me with this question.

Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The primosome complex includes primase, helicase and gyrase. 2.In plasmid DNA biotechnology, plasmid inserted with a “correct" DNA sequence is transferred to bacteria for rapid.

A cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHI

I don't need explanations Just answer choices please. And Are the selected answers choices for 1-4 correct?

Part 4. Putting It Together 1) Consider the diagram below as well as the given information. This diagram represents a piece of circular DNA which was cut in 4 separate reactions (4 different test tubes, each with some of this DNA in it). One digest was done with AvaI, another with ClaI, a third with EcoRV, and a fourth with ScaI. The locations of the recognition sequences for each restriction enzyme are shown along with the location of that site in bp along the circle (it goes clockwise from position 1). You run an agarose gel with a molecular weight marker in the first lane, the AvaI digest in lane 2, the ClaI digest in lane 3, the EcoRV digest in lane 4, and the ScaI digest in lane 5.   a) Use the space below and draw out the agarose gel described above. Use your drawing to answer the next questions. b) How many bands of DNA are there in lane 3?   c) How many bands of DNA are there in lane 5?   d) There would be 2 bands of DNA in lane 4. How big are they?   e) Which lane…

Please answer the rest

Please answer asap

Please help with this as soon as you can, thank you.

General Biology - B. Arrange the following C. Answer the question You can read each instructions for clarification, thanks!

Please answer all the questions. I'll definitely give a like.

Please help with all parts of this problem. Double check your answers.

a. What is the function of the SDS in the lysis buffer? the NaOH? b. What does the potassium acetate do in the procedure and why?

True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs of similar sequence 4. In genomic DNA, on average EcoR1 restriction sites are more common than Mse1 restriction sites 5. Tags such as HA that are fused to proteins always compromise their function.

Can I get help with that question please

Submit your restriction fragments pUC19 cut by Ava II and Pvu II. Submit your plasmid map with the restriction cut sites labeled. Show all work.

please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.

= Menu #1 Mol Bio Restriction An... X + Create All tools Edit Convert E-Sign Sign in Find text or tools H 3. If the PMBBS plasmid were digested with all three REs together, how many fragments would be observed, and what would be the sizes (in bp) of these fragments? Number of fragments: Sizes: 4. Draw the actual map of the PMBBS plasmid, following the style of the sample map shown in Figure 1. Make sure you show the following information: (1) relative locations of the RE sites; (2) size in base pairs of the segments of DNA between sites. (The map need not be drawn to scale.) Answer: (provide a drawing) NFL Q Search IA W ☑ 0 Al Assistant C 2 2 C 1:1 ༢ ☑ 8:58 PM 10/22/2024 Q

Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes   EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'

please help

1a.The complete genotype of the host yeast strain is MATa ade2 his3 leu2 met15 ura3.  Name one advantage of using a yeast strain with auxotrophies for several genes (i.e. his3, leu2 and ura3). b.)After successful CRIPSR editing, the yeast can later be “cured” of the recombinant CRISPR plasmid – that is, the plasmid is lost but the CRISPR edit is stably inherited.  Write the new genotype of the yeast based on ADE6 gene.