BSC324%20study%20problems%20II%20FALL%202023

Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…

practice problem genetics

ACTIVITY 7.3.2 1. Name differences between replication and transcription. 2. Write the sequence of the RNA transcribed from the following DNA: 5' GATCAATGCTAG 3' 3' CTAGTTACGATC 5' 152 Copyright 2019. All Rights Reserved.

Part II: Information Transfer Background Information - Key Points The background information provided for this lab has given you a general overview of some of 24 the key terms and definitions necessary to understand the transfer of information from gene to protein. The information included below will help you work through the specific problems included in your Tutorial 4 Assignment. When working on the problems remember the base mu to pairing rules (Table 3). Table 3: Rules for nucleotide base pairing. cytosine (C) - guanine (G) adenine (A)- thymine (T) DNA RNA For Transcription: ● ● ● ● cytosine (C) - guanine (G) adenine (A)- uracil (U) Initiation is determined by the recognition of the promoter sequence in the DNA by the RNA polymerase. Stef The transcription start site is downstream of the promoter and is designated as the +1 site. Aspartic acid Alanina Valine Arginine Serine Lysine Asparagine Glutamic TEOPO|0C|AGUCAG|UC|AG/DCAG/3G/ CAGUC UGU A C A Threonine G Methionine Isoleucine…

Solve it asap... All parts otherwise I will downvote

Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG

justify the answer and explain your reasoning

3. Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human protein is as follows (the mutation is highlighted in red): CUUGUUAACAACUAAACGAACAAUCUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAG UCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCAC ACGUGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGA CUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGUAA RT-qPCR can be used to detect the variant (mutation). (a) In a few sentences or using a simple diagram/flowchart, describe the basic principle of RT-qPCR, and show the sequence of a DNA primer that can be used to reverse transcribe the entire RNA molecule as shown at 37 °C. (b) Design a pair of primers (DNA oligonucleotides) for detecting the mutation by qPCR. Assume that the PCR reaction will be performed at 72 °C. Show the sequences of your primers and their estimated Tm.

Practice test

Do all

1. How many codons are there in the Original DNA sequence?

Question Guide: 1. Name and write the structures of the purine and pyrimidine bases present in DNA. Purine Рyrimidine Structures: Purine Pyrimidine

Please help me answer the GENETIC CODE problems 1. Describe the expirement that allowed researchers to first identify the codon for a specific amino acid. 2. Which of the following statemts about the genetic code are true and which are false? Please correct each false statement. a. Each codon is composed of four bases b. Some amino acids are represented by more than one codon c.All codon represent an amino acid d. Each living species is thought to have its own unique genetic code. e. The codon AUG at the beginning of a sequence is a signal for protein synthesis to begin at that codon. f. It is not known if the code contains stop signals for protein synthesis. Thank you very much for your help.

Complete number five.. please explain

2. How many codons are there in the mRNA?

I would like you to solve question 12.

8:52 Protein 2-10092015113649.pdf https:api.schoology.comv1attachment169963839... Name Class Date Interpreting Diagrams: Understanding the Main Ideas The Genetic Code (MRNA) Lysine Lysine Asparagine Asparagine Arginine Arginine Serine Serine Isoleucine Methionine Isoleucine Isoleucine Threonine Threonine Threonine U Threonine c Glutamic acid Glycine Glutamic acid Glycine Aspartic acid Giycine Aspartic acid Glycine Valine Valine Valine Valine Alanine Alanine Alanine Alanine "Stop" codon "Stop" codon Leucine Trytophan Cysteine Cysteine Al Gl "Stop" codon Tyrosine Тугosine Serine Serine Phenylalanine Serine Phenylalanine Serine Leucine Glutamine Giutamine CHistidine Histidine Arginine Arginine Arginine Arginine Al Leucine Leucine Leucine Loucine Proline Proline Proline Proline Icl A G Second Base in Code Word Use the information in the accompanying figure to complete the following table. The first row has been completed to help you get started. DNA codon MRNA codon IRNA Anticodon Amino…

I need help with a matching biology question: This is a single stranded molecule that in Eukaryotes passes from the nucleus to the cytoplasm. This makes up the ribosomal subunits and reads the mRNA. They carry amino acids during the process of translation. The structure is the site of translation. This is the enzyme complex that is used to copy DNA during transcription   matched with: ribosome mRNA rRNA tRNA RNA polymerase

6. What codons ar e found in the mRNA for the two mutated DNA?

help..

Question in Image. Thank you!

Practice HW  make a nucleotide sequence (Template strand and Coding strand) of at least 15 base pairs for each of these steps to show your understanding of how genetic information is stored and used within a cell make sure that there are start and stop positions and note the direction of the sequence--- 5’ to 3’ or 3’ to 5.

Task 1: Compare the characteristics of DNA to RNA. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. DNA RNA No Answers Chosen No Answers Chosen DNA & RNA No Answers Chosen Possible answers Phosphate group | Cytosine Adenine Basic unit is the nucleotide Single strand Double helix E Phosphate-sugar backbone | Uracil | Guanine | Thymine :::: ::::

10:14 Protein 5-10092015113503.pdf https:api.schoology.comv1attachment169963838... Name Class Date RNA (pages 146-148) | SECTION REVIEW In this section you were introduced to the molecule that helps put the information in DNA to use: ribonucleic acid, or RNA. ANA Iis a nucleic acid that carries information from DNA to the ribosomes, the organelles in which proteins are made. RNA also carries out the process by which proteins are assem- bled from amino acids. RNA is quite similar to DNA in structure. However, there are some important differ- ences. RNA is single-stranded; DNA is dou- ble-stranded. RNA contains the sugar ribose; DNA contains deoxyribose. And RNA has the nitrogenous base uracil; DNA has thymine. In this section you also learned about the process of transcription. Transcription is t process in which part of a DNA molecule is used as a template for the synthesis of a com- plementary strand of RNA. This process is mediated by an enzyme called RNA poly- merase. The strand of…

Please also help with this one . I am not sure what to do when I encounter a STOP codon.

11 da 152 Chapter 13 ? QUESTION mRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Alanine Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Chel Glycine Hietidling Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine mRNA Codons GCU AGA AAU GAU Kayles Kauffen UGU GAA CAA GGU CAU AUU CUU AAA AUG UUU CCU UCU ACU UGG UAU GUA Code-End of the (anticodon) tRNA There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table. 2. What is the one-gene-one-enzyme hypothesis? 4. Where are tRNA and mRNA made? 3. Which molecule copies the DNA message for building a particular protein? What is this process called? 5. How many different amino acids are there in living…

Question:- A mixed copolymer was synthesized using 2 parts Cytosine and 1 part Adenine and the resulting mRNA was used for translation. What is the probability of producing the following amino acids? NOTE: Answer in fractions only. 1. Threonine _____ 2. Asparagine _____ 3. Histidine _____ 4. Lysine _____ 5. Proline _____

Just Question 4

8:47 ll 5G% 4 Chapter 9 DNA worksheet 2022.d... 2. Write the mRNA transcript from the DNA template in question 1. Remember your enzyme for RNA polymerase must add RNA nucleotides starting with the 5' direction and moving to the 3' direction. So for the MRNA copy the strand of DNA that is 3'-5') 3. Refer to the codon chart at the bottom of the page. Translate the mRNA into a polypeptide using the following rules. (2 points) Direction of translation of mRNA is from 5' to 3'. 1. MRNA codons are read in groups of three nucleotides. 3. Translation must begin at the START codon. 4. the STOP codon terminates translation. 2. THIRD LETTER SECOND LETTER U TulUUU Phe UUC Phe UUA Leu UUG Leu A UGU Cys U JUGC Cys C UCU Ser UAU Tyr UCC Ser UAC Tyr UCA Ser UAA STOP UGA STOPA UCG Ser UAG STOPUGG Tp G CCUU Leu CÚC Leu CỦA Leu CUG Leu AJAUU Ile AUC Ile AUA Ile AUG Met STARTACG ThrAAG Lys GGUU Val GUC Val GUA Val GUG Val CCU Pro CAU His CCC Pro CAC His CCA Pro CAA Gln CCG Pro CAG Gln ACU ThrAAU Asn AGU…

Help me on this ?

Complete the following problems.  1. Draw a molecule of phosphatidyl serine using palmitic acid and linoleic (Δ9,12) acid 2. Consider the following coding strand sequence of DNA to a corresponding amino acid sequence. This represents the first amino acids to be translated. Underline the codon where translation will be initiated, and give the amino acid sequence of the peptide produced.                5’-CGATGCTCAAGTTTC-3’ 3. Within the matrix of the mitochondria, the pH is approximately 6.8 ([H+] = 1.6 X 10-7), while it is 7.4 ([H+] = 4.0 X 10-8) in the intermembrane space outside the matrix. Calculate the free energy driving transport of hydrogen ions from the intermembrane space to the matrix. Remember to include both the concentration and the membrane potential factors. 4. Draw the adenosine-5’-diphosphate.