Cancer final study guide 3

Please read carefully questions are meant to purposefully be tricky at times 30. Which of the following statement relating to the cell nucleus is false?  a. all body cells are nucleated b. the nuclear envelope is a non-porous double-layered membrane c. contains nucleoli that are involved in tRNA synthesis d. all of the above e. none of the above

2. What would happen if a mutation in DNA changed codon 6 in the MRNA to GUA? (This one nucleotide substitution creates sickle-cell anemia.) 3. How does a mutation change the events at the ribosome?

5. Match the description to the molecule(s). Each choice will be used only once. a. DNA b. mRNA C. tRNA d. more than one of the above e. none of the above A molecule of this will always have an equal percentage of A and T and an equal percentage of C and G: Has an anticodon and carries an amino acid: Serves as a messenger for taking genetic information from the nucleus to the cytoplasm: Is involved in the process of translation: Is a component of ribosomes: 54 Copyright 2016 Pearson Education, Inc. Chapter 10: The Structure and Function of DNA WATS f12 16 f7 18 +1 f9 10 %24 4. 8 5.

5.  How does chloramphenicol inhibits bacterial translation ? Group of answer choices changes shape of 30S portion of the prokaryotic ribosome ; initiates incorrect reading of mRNA codons binds to bacterial t- RNA binds 50 S portion of ribosome; inhibits  ribosome translocation bind irreversibly to the small ribosomal subunit binds to large subunit ; inhibits peptidyl transferase activity interferes with attachment of t- RNA to m-RNA in ribosome complex   6. Which of the 2 are NOT target of antibiotics on microbes? Mark both answers Group of answer choices iron uptake lipopolysaccharide synthesis protein synthesis cell wall synthesis plasma membrane injury nucleic acid synthesis

Which of the following statements about ribosomes is correct? *   a. the number of ribosomes in a cell seldom exceeds 50   b. the active site of a ribosome contains mostly protein molecules   c. structurally, ribosomes have two rRNA- protein subinuts   d. no correct response   What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3' ? *   a. 3' C-T-A-G-A-T 5'   b. 3' C-G-G-A-T-A 5'   c. 3' G-A-U-A-U-G 5'   d. 3' G-A-T-A-T-G 5'   The product of the first phase in protein synthesis is *   a. DNA molecules   b. RNA molecules   c. both RNA and DNA molecules   d. neither RNA and DNA molecules

3

9. After the process of DNA replication, there are two newly formed strands of DNA in each double helix. Group of answer choices True False 11. Translation involves tRNA bringing in codons with amino acids attached to match with the mRNA which is coding for those amino acids. Group of answer choices True False 14. Hershey and Chase were scientists who conducted experiments that demonstrated that DNA is the genetic material of bacteriophages. Group of answer choices True False   PLZ ANSWER ALL

1. Which protein and nucleic acid molecules are present in the PDB structure with code IKX3? Histones 2A and 2B and DNA only. DNA only. Histones 3 and 4 and DNA only. Histones 2A, 2B, 3, 4 and DNA. DNA ligase. 1. 2. 3. 4. 5. Which amino acids would you expect to find buried in the interior of peripheral membrane protein? 1. leucine, methionine 2. threonine, glutamate tyrosine cysteine 3. 4. 5. lysine, arginine histidine, glutamic acid A basic leucine zipper 1. 3 is the name of a full transcription factor protein. interacts with RNA polymerase. is a portion of a full transcription factor protein. is used to join any type of protein domains. cause aggregation of transcription factors. 4 DNA methylation acts to inhibit gene expression by 1. altering the DNA structure and interfering with proteins that bind. changing binding of histones to DNA. 3. activating the binding of bromodomain containing proteins. 4. 2. forming acetyl groups. changing the TATA box sequence. 5. A-2345 2.

8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making multiple copies of an mRNA molecule after it has been transcribed from DNA B. Converts a protein sequence to mRNA

8. Which serves as the template for the assembly of amino acids during protein synthesis? * A. DNA B. MRNA C. FRNA D. TRNA 9. Which of the following is the correct sequence of protein synthesis? * A. replication – translation – transcription B. translation – transcription – replication C. replication – transcription – translation D. translation – replication - transcription 10. Which of the following about mutation is TRUE? * A. Mutations may affect only one gene, or they may affect whole chromosomes. B. Mutations in body cells affect only the individual and are not passed on to the offspring. C. Mutations in eggs or sperm affect future generations by transmitting these changes to their offsprings. D. All of the above 11. 1st The endocrine system consists of glands that secrete chemicals called hormones to control various body processes. 2nd This control system usually brings about slow changes in the body because chemical messengers move more slowly than nerve impulses. A. both…

8. Some antibiotics work by preventing protein synthesis in bacteria by binding to their ribosomes. Which statement explains why these antibiotics kill bacterial cells but not human cells? A. Antibiotics recognize human genes but not bacterial genes B. Ribosomes in human cells have a different structure to those in bacterial cells C. MRNA in bacterial cells is not processed before translation D. Both DNA and ribosomes are located in the cytoplasm in bacteria E. Ribosome in human cells is located inside the nucleus 9. Shine Dalgarno sequence is A. an RNA component of ribosome В. а romoter sequence C. a sequence for initiator tRNA binding D. located upstream of the coding sequence E. a sequence for recognition by RNA polymerase holoenzyme 10. Which of the following statements about ribosome is INCORRECT? A. Ribosome consists of protein and RNA B. 50S subunit can't bind to 30S subunit till IF1 an IF3 dissociate from 30S subunit C. Energy is consumed when ribosome moves along the mRNA in…

3

1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it up into codons. 3. Plug the codons into the amino acid chart to determine the correct amino acid needed to build that protein. 4. Identify the protein you made by comparing the sequence to the pictures 5. Answer the questions for each protein molecule you build before moving on to the next. Protein 1: DNA AAGACCGTATAC MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?

3. Draw a ribosome translating a protein from an mRNA template. Label the parts! Where is this happening in the cell?

4)Which of these molecules is responsible for bringing the correct amino acid to the ribosome? acetyl transferase mRNA RNA polymerase rRNA tRNA DNA None of these

Beta-lactam antibiotics work by? O A. cleaving peptide side chains O B. preventing cross-linking of the peptide side chains by transpeptidase O C. cleaving the 1,4 beta-glycosidic bond between the NAM and NAG © D. inhibiting the action of bactoprenol O E. preventing peptidoglycan from being flipped to the external side of the plasma membrane

Which of the following is incorrect? a. Amino acids may have one or more triplet codes or codons b. Translation refers to the synthesis of RNA DNA replication is possible due to the complementarity of the two strands of DNA Od. A mutated gene can cause disease O c.

14. The nucleotide sequence of a DNA codon is CTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon? a. GAT b. CTA C. CỦA d. GAU

1. how is information from the DNA passes on from one cell to another?2. How does the structure of a DNA molecule hellp account for the great variety of life that exists on earth?3. Does your mRNA model more closely resemble the DNA strand from which it was transcribed?4. Explain how the structure of DNA enables the molecule to be easily transcribed. Why it is important for genetic information?5. Why is RNA important to the cell?6. How does the mRNA molecule carry information from DNA?

#24

1.  The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase. Which molecule catalyzes this reaction?

1. The production of arginine is terminated by the presence of excess arginine. State which phenomenon is responsible for this outcome. Explain the phenomenon in brief. 2. Suppose, a group of scientists developed a recombinant enzyme having mutations in its active site. Do you think, the activity of an enzyme would differ from the wild type? 3. Which part of the cell has a model structure of a fluid mosaic? Why do you think this happens?

12.  Penicillin only works on actively dividing bacterial cells because:  a. it inhibits peptidoglycan (PG) synthesis   b. it inhibits LPS synthesis  c. it is no longer is effective against RNA and translation  d. a & b  e. a & c

35. Which of the following statement relating to the cell nucleus is inaccurate?  a. all body cells are nucleated b. the nuclear envelope is a non-porous double-layered membrane c. contains nucleoli that are involved in tRNA synthesis d. a and b e. a, b, and c

8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? B 5' AGATGCCCТАAGGTCATTGTT 3' 3' TCTACGGGATTCCAGTAACAA 5' C A. Α В. В С. С D. D E. None of the above

36. In the cell depicted in the picture, the ribosome is labeled b. c. d. 37. A gene mutation is none of these b. may orise spontaneously. a change in the nucleotide sequence of DNA. is is all of these. e. moy be caused by environmental agents. c. d. 1P BDACE

1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…

Please answer fast 1. The cell wall in bacteria is designed;   a. to help resist changes in osmotic pressure   b. to cause creation when it's lacking   c. to maintain rigidity of shape   d. all of these   2. What is a characteristic exhibited by an extrachromosomal piece of DNA?   a. It can also exist as a plasmid   b. It is a body found in the cytoplasm that directs protein synthesis   c. It is a chromosome   d. It is a molecule that carries the genetic message of the chromosomal DNA.

21.An RNA or DNA molecule is a polymer made of subunits called 22.Which of the following is NOT needed for protein synthesis a, tRNA b, spindle fibers c, enzymes d, ribosomes   23. What does DNA do inside the cell? it destroys incorrect nucleotides in the nucleus it maintains the integrity of the nuclear membrane It prevents the excess buildup of nucleotide bases it directs the synthesis of proteins   24. What is a genome? Group of answer choices The complete collection of an organisms genetic information The combination of proteins and DNA found in the sex cells All the genes found in a population The number of chromosomes found in each cell