Thakkar_Vraj_Wk5

15

9

Urgently needed

Lesson 2 Focus Questions 1. What chemicals and molecules are needed for PCR, and what is the function of each component? 2. Examine the 150 base promoter sequence below. Kaylee Kauff 5'TAGAAAAGGA AGGTGGCTCC TACAAATGCC ATCATTGCGA TAAAGGAAAG GTATCATTC AAGATGCCTC TGCCGACAGT GGTCCCAAAG ATGGACCCCC ACCCACGAGG AGC ATCGTGG AAAAAGAAGA CGTTCCAACC ACGTCTTCAA3' Write in the sequence of the complementary strand and mark the 3' and 5' ends of the complementary strand. 43

G-Unit 5: DNA anc X https://docs.goog x y google classroom x A Classes QLSeyPC6Kmoa0k5JJd1DWGzqqRwaQQobHNOOdqFX_aDbV_6-bKw/formResponse of Distance Le... Launch Meeting - Z.. 4 2020 HORNETS 4N... StudentVUE Clear s How is a protein made in the cell? * One strand of DNA in the ribosome combines with amino acids. Two strands of DNA in the nucleus combine with amino acids. One strand of RNA in the ribosome is the template (model) for an amino acid sequence. Two strands of RNA in the nucleus are the template (model) for an amino acid sequence. Use the chart to determine the correct amino acid that this DNA would code for - ATA EGFL Y. UCAGUCAG Gutame Aspart ac

1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8

Final Assessment for Exploring M X forms/d/e/1FAIpQLSe8RrfvHEr59pISGjbEneL041GxKTvyw9-Xc_EA7Um_8xqReA/viewform?hr_submission-Chg1990yzQ8SEAjwvY285... First mRNA base (5) end of codon) A Sequence C Sequence D 5. A DNA sequence of "ACG" will code for the amino acid UUG CUC CUA CUG wh GUC GJA GUG Cys 100 AUU AUC lle ACC AUA ACA AUG MACG] Val M Second mRNA base UCA UCG The GCU GCC.. GCA GIGA CAA CAG Tyr UAC UGC UAA Stop UGA Stop A UAG Stop UGG Tro AAU AAC MT AAC GAC GAG 2 Lys Asp CGA CGG AGU AGC AGA AGG Lys GGU GGC GGA GGG Arg DUAU Gly C Third mRNA base (3' end of codon) Lys (K) DELL C GU A C DEOTOCCAGUCAGUCAGUCHOSOTOS M G (F) A (LS1-1) * GU A C CUGA OPCUGACU GACUSACCO AD A G OCO Trp (W) \u« 9799%3Fo 33 4

4:39 PM Thu Jul 25 < Cames A Help Center? Spokane Today 10:10 AM You study cells in which DNA synthesis rates are influenced by a ligand that binds to a receptor tyrosine kinase (RTK: must polymerize and cross-phosphorylate to transmit its signal). To determine which protein(s)-A, B, C, or D- are responsible for the activation of DNA synthesis, you construct mutant versions of the RTK that retains one or more of the tyrosines that are the protein docking sites (+ means the tyrosine is present and gets phosphorylated," means the tyrosine is not present). You express these mutant versions in cells and measure the level of DNA synthesis. (A) (B) 740 751 BP 771 B 1009 1021 100- 50- 山 protein P-site 1 2 3 4 5 6 7 8 9 A 740, 751 B 771 C 1009 D 1021 First: Maintenance of which docking protein(s) binding site is required maximize DNA synthesis? [Select] Second: Which protein has no detectable role in DNA synthesis? | Select] MacBook Pro Edit

Question e

Drag the labels onto the diagram to identify the anatomical terminology describing body orientation and direction (human a Posterior (caudal) Distal Superior (dorsal) Proximal Inferior (caudal) Anterior (ventral) Posterior (dorsal) Pearson arch

Questions and situational problems I. A particular gene codes for a mature mRNA containing 900 bases, which is translated into a 40 kDa protein. A mutant form of the gene created by a single point mutation yields an 830-base mature mRNA yielding a 37 kDa protein with modified enzymatic activity. The analysis shows that the mutation has resulted in a 22 amino acid deletion within the protein. What is the most likely effect of the mutation? Explain.

Problem #2 DNA TACT TAA A AAT G A (TS) DNA (CS) MRNA Amino Acids: Please continue to the next page. Activity 2- Reinforcing Protein Synthesis Use your codon chart to determine the amino acid sequence. Read through the strand and ONLY start on AUG and STOP when it tells you to stop. Follow example below: Example: DNA > AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA > UCU GCC AUG GAG GC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG protein > start - glu - ala -thre - hist – asp -glu – threo - stop 1. DNA → CCT CTT TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCCATA ATC MRNA protein > 2 DNA → AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA > pratein > 3. DNA > TAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTCGCC ATC MRNA > protein → 4. Fill in the diagram below. DNA MRNA ERNA Amino Acids Please continue to the next page. Universal Genete Code Chart Mensenger RNA Codans and the Amina Asd for Which They Code SECONDBASE…

Question In Image Thank you!

Questions related to SARS-CoV-2 Inhibitor Science Article (Zhang et al.) 1) What is the function of the viral main protease? 2) What is the amino acid recognition sequence that is cleave by this main protease? Indicate where this protease cuts? 3) Would interfering with this protease effect other proteases in human cells? 4) How closely related are the amino acid sequences between SARS-CoV-2 and SARS-COV? What does this suggest about focusing research on inhibiting this enzyme?

Task #3: Design primers 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac cgagacctgg gccggtgagt gcgggtcggg agggaaatgg 121 cctctgccgg gaggagcgag gggaccqcag gcgggggcgc atgacctcag gagccgcgcc 181 gggaggaggg tcgggcgggt ctcagcccct cctcaccccc aggctcccac tccatgtggt 241 atttctacac ctccgtgtcc cggcccqgcc gcggggagcc ccgcttcatc tcagtgggct 301 acgtggacga cacccagttc gtgaggttcg acagcgacgc cgcgagtccg agagaggagc 361 cgcgggcgcc gtggatagag caggaggggc cggagtattg ggaccggaac acacagatct 421 acaaggccca ggcacagact gaccgagaga gcctgcggaa cctgcgcttc tactacaacc 481 agagcgaggc cgttgcqtga ccccqgcccg gggcgcaggt cacgactccc catcccccac 541 gtacggcccg ggtcgccccg agtctccggg tccgagatcc gcctccctga ggccgcggga a) First you'll need to design primers to PCR-amplify amino acids 45-56. i) Record the sequences of the forward and reverse primers, in the 5' to 3' direction. Each primer must be 8 nucleotides long (note that normally primers are much longer than this). Show intermediate steps…

PLEASE HELP, LONG ANSWERS WOULD BE APPRECIATED

Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide   5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'

Short questions

Practice question 1D) In the boxes on the image, label the N and C termini of the csRu protein. . Also on the schematic above, draw the csRH protein as you would find it at the plasma membrane. Be sure to label the N and C termini of the protein you draw to indicate its orientation. The csRu MRNA and protein are represented in the diagram below. mRNA 5' AUG 3' ribosome protein DNA ligand binding domain signal kinase transmembrane binding domain sequence domain domain cytoplasm plasma membrane extracellular fluid