Week 15 Sequence Analysis Worksheet

.docx

School

University of Louisville *

*We aren’t endorsed by this school

Course

241

Subject

Biology

Date

Apr 3, 2024

Type

docx

Pages

Uploaded by KidRockKingfisher27

Today, you will complete this worksheet as you determine the species identity of your bacterial sample. Remember that this is group work, and you will upload your completed worksheet to Blackboard by the deadline determined by your GTA. INTRODUCTION Welcome to the final week of this semester’s CURE! You’ve done the hard laboratory work, and today we are going to finally determine what species of bacteria live in your soil sample! After you ran your agarose gels, we took the successful samples and sent them out for Sanger sequencing (having done the pre-lab, you now know how Sanger sequencing works!). If your sample was successful, your GTA will give you your chromatogram and the sequence file. If your sample was not successful, your GTA will provide you with another sequence to use. As you are working through this worksheet, you will be collecting information that you will use for your species report. MATERIALS  Laptop computer with internet access  Chromatogram .pdf file (provided by GTA)  Sequence .seq file (provided by GTA) 1 SEQUENCE ANALYSIS BIOL 241 Group members present: 1.Tori Neudecker (primary scribe) 2. 3. 4. LEARNING OUTCOMES By the end of this lab you will be able to  Describe the principles of Sanger DNA sequencing  Interpret a chromatogram  Use BLAST to assign taxonomic identity to an unknown sequence  Use Google Scholar to find and cite sources

PART 1: Working with a chromatogram Sanger sequencing, as you learned in your pre-lab assignment, works by adding fluorescent terminal dideoxynucleotides that stop the synthesis of a new strand of DNA once they are added. This results in a number of DNA fragments that differ in length, and each has either an A, C, G, or T nucleotide at its end that will fluoresce when struck by a laser. An extremely precise version of gel electrophoresis separates the fragments by size, and a fluorescence detector measures the type of fluorescence at each fragment’s end. The result is a chromatogram, which shows the fluorescence at each base pair location. The intensity of the fluorescence is then used to determine the base pair sequence of DNA. Let’s practice using a chromatogram to determine the sequence of a piece of DNA. Below is a chromatogram from a research project that one of your professors did when they were an undergraduate student. In chromatograms that we will be using in this class  blue fluorescence indicates C  red fluorescence indicates T  green fluorescence indicates A  and black color 1 indicates G Given this information, determine the sequence of the DNA piece in the following chromatogram (your answer should be written in this format: 5’ AGTGA 3’) Write this sequence here ( 1 points ) 5'TTATCCTAGATTAGGAGGATCGTGGGG3' The project from which the above sequence was obtained investigated the sequence diversity of a particular gene that regulates crossing-over frequency in house mice Mus musculus . Mice, like all mammals and vertebrates, are diploid organisms, meaning they have a copy of each gene on two homologous chromosomes. When we amplify genes of diploid organisms using PCR, we amplify alleles for the same gene from both homologous chromosomes. Consider 1 As you may recall from your pre-lab, the last fluorescent probe is yellow, but black is used in its place in the chromatogram so that it is easier to see. 2

Chromatogram 2 (below) of the same exact gene region as the above chromatogram but from a different individual. What is different between Chromatogram 1 above and Chromatogram 2 below? Can you tell with certainty the sequence in Chromatogram 2 ( 1 point )? Knowing that both of these chromatograms accurately depict the DNA sequence (i.e. there were no mistakes during PCR or sequencing), how would you describe the genotype of the individual in Chromatogram 2 in the 8 th , 13 th , and 23 rd nucleotide positions in this gene (hint: use vocabulary from the BIOL 240 Mendelian Genetics lectures) ( 1 point )? In genomics, the term that is used to characterize nucleotide variation at a specific location is Single Nucleotide Polymorphism or SNP. How many SNPs does individual from Chromatogram 2 have ( 0.5 points )? Imagine that the individual in Chromatogram 2 is the offspring of the individual from Chromatogram 1 and another unknown parent. Given this information, what was the sequence of this gene in the unknown parent, assuming that this unknown parent was homozygous? Your answer should be written in this format ( 1 point ): 5’ AGTGA 3’ 3 They appear to be different heights. Some are taller and some are shorter in both graphs.

What evolutionary process created differences in DNA sequences between the parent from Chromatogram 1 and the unknown parent ( 0.5 points )? PART 2: Inspecting your chromatogram It’s time to inspect your own chromatogram! Your GTA will provide you with chromatograms as a PDF file. Unfortunately, not all PCR reactions worked and around half of the Sanger sequencing reactions typically do not produce interpretable data. That is fine, do not worry! PCR and Sanger sequencing often fails even for practiced microbiologists, that’s part of science! If you do not have your own chromatogram or if the chromatogram from your sample is very messy and does not have even, non-overlapping peaks, ask your GTA to provide you with one from the rest of the course. If you are unsure if your chromatogram is OK, ask your GTA! For the rest of the worksheet, each group member will be working on a different chromatogram, but you will be submitting one worksheet. Once each of you have obtained a chromatogram with “good” peaks, one of the first things you will see in your chromatogram is that the beginning and the end of your chromatogram are a bit messy. That’s because the sequencing reaction doesn’t work very well at the very beginning and end of your sequence. If you look closely, the chromatogram shows the nucleotide position right below the fluorescence peaks. At what nucleotide position can you BEGIN to be confident about your DNA sequence? I.e., when do the peaks begin to be very well-defined and non-overlapping? Make sure you provide a specific nucleotide position ( 0.5 points ). Group member name Tori Neudecker Nucleotide position at which peaks begin to be well-defined 5'GCTAATAT3' from 10 to 20 At what nucleotide position do you STOP being confident about your DNA sequence? Make sure you provide a specific nucleotide position ( 0.5 points ). Group member name Tori Neudecker Nucleotide position at which peaks stop to be well-defined 5'GGGGCCCGCAC3' from 900 to 910 4

In the region of well-defined peaks in the middle of the chromatogram, do you see any SNPs? If so, how many ( 0.5 points )? Group member name Tori Neudecker Are there SNPs in the well-defined region? Yes, 4 If you do NOT see any SNPs, here is an example of a barcoding chromatogram with a lot of “SNPs”. Given that a) in your PCR you amplified a bacteria-specific sequence from a specific colony, b) bacteria replicate using binary fission, and c) all bacteria are haploid organisms, would you expect any SNPs in bacterial sequences ( 0.5 points )? No If a bacterial sequence DOES show SNPs, what could have gone wrong during colony picking and/or the subsequent PCR? Explain your reasoning and refer to ploidy in your answer ( 1 point ). Let’s think a little bit more about this gene and link it back to the LOs from the Central Dogma topics from BIOL 240. The gene you amplified encodes a ribosomal RNA (rRNA). Does this gene encode a protein ( 0.5 points )? yes no Given your answer above, what steps of the Central Dogma will the cell use to express this gene ( 0.5 points )? transcription only translation only both transcription and translation 5 If contamination occurs, pcr, or presence of bacterial strains can cause detection of SNPs in a bacterial sequence.

neither transcription nor translation PART 2: BLASTing your sequence Let’s return to the main point of this CURE – to assess the diversity of bacteria in the soil samples that you and your classmates collected! As you recall, we amplified the 16S region from the gene encoding bacterial ribosomal RNA because this stretch of DNA evolves sufficiently slowly to be the same within species, but sufficiently fast to be variable among species. We can therefore use it to determine the species identity of your bacterial colony! But how? Fortunately, you are not the only scientists studying soil bacteria! There are other scientists who have amplified the 16S sequence from known bacterial species all over the world and uploaded it to the National Center for Biotechnology Information (NCBI). NCBI has a very useful tool for us to quickly find out if there is a sequence match to our bacterial isolate in the NCBI database: Basic Local Alignment Search Tool (BLAST). Sometimes there will not be a perfect match for your bacterial species in the NCBI database. That’s normal! BLAST will look for the best matches to your particular sequence to identify which bacterial species your sample is likely to be. It’s time to open your sequence file (that ends with .seq)! Your seq file must be from the same sample as the chromatogram that your worked with above – each of you will be working with your own .seq file. Open your .seq file using your computer’s text editor. To do this, right-click on the .seq file, then select “Open with..” and find your computer’s text editor. o For Mac users, your default text editor is TextEdit o For Windows users, your default text editor is Notepad Your sequence will look like this >NAME_OF_THE_SAMPLE AGTCTCTTCAAGGTCAGCTCCGATCGAC This is the same sequence as in your chromatogram, but here it is formatted as a simple text file using the FASTA style. We are now ready to BLAST your seqeuence! 1. Go to NCBI blast: https://blast.ncbi.nlm.nih.gov/Blast.cgi (or simply Google NCBI Blast). 2. Press on the Nucleotide BLAST button. 6

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version