Case Study 7- Mechanisms Of Action

Which of the following processes of genetic information flow can occur under lab conditions, but has never been observed to occur under natural conditions (either in living cells or in viruses)? transcription of RNA from a DNA template (using DNA-dependent-RNA-polymerase) self-replication of RNA from an RNA template (using RNA-dependent-RNA-polymerase) direct-translation of protein from a DNA template (using special ribosomes) self-replication of DNA from a DNA template (using DNA-dependent-DNA-polymerase) translation of protein from an RNA template (using ordinary ribosomes)

Ihsan is a biologist working with the genetics of a psychrophilic bacterium. He cloned an antifreeze gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Ihsan finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.

Damien and Jessica are friends that are interested in proteomics. One day Damien and Jessica go to a proteomics lab to have their proteome (all proteins in body) analyzed. The analysis shows that there is a difference in one amino acid within each of their hemoglobin proteins. However, both of their hemoglobin proteins appear to be functioning properly. They both come to you and ask you the significance of this finding, what do you tell them? Should they be worried? Provide a detailed rationale. .

Forty years after its development, the use of recombinant DNA technology is widespread and is found even in many middle school and high school biology courses. Are there some aspects of gene splicing that might be dangerous in the hands of an amateur?

A certain template DNA strand has the following nucleotide sequence:                                   3’-TACTCGATGCTGTGCGAT-5’ a)      What would be the nucleotide sequence of the complementary nontemplate DNA strand? What is this process called and where does this occur in the eukaryotic cell?   b)      Take the template strand through the process of transcription.  What is the resulting strand called and where does this process occur in a eukaryotic cell.   c)       Take the template strand through the process of translation including the location in the cell.  You should finish with a polypeptide chain. You will need to use the Genetic code found in your notes/book

The design of antibiotics requires that the drug prevents the growth of bacteria without compromising cellular functions in humans. I’d like you to think of the differences in the process  of gene expression in prokaryote and eukaryotes and suggest two possible targets for the design of an antibiotic. Explain what processes you are preventing (you can include replication if you’re familiar with this process) and how your drug would be targeted to affect prokaryotes only.

As we described in class, in the early 1960's Francis Crick and colleagues set out to determine how many nucleotide bases make up a codon, before it was possible to sequence DNA and before Nirenberg and his colleagues solved the genetic code. To do this, they used a chemical mutagen that they knew made single nucleotide changes, used this mutagen to conduct a screen for mutations that disrupted a particular gene, and collected a number of different mutations in this gene. Briefly describe the logic they used to deduce that the codon length is 3 nucleotides long.

i and ii

You are studying the tryptophan synthetase gene that Yanofsky also examined to determine the relationship between the nucleotide sequence and the amino acid sequence of the gene. Yanofsky found a large number of mutations that affected the tryptophan synthetase gene. A) If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located? B) Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also recovered a nonsense mutation that changed amino acid number 15 into a stop codon. This codon normally encodes Lysine. Does the recovery of this mutation support the hypothesis that this Lysine residue is critical in the function of the tryptophan synthetase protein?

Whole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied diagnosis by traditional means. The implication here is that exons in the nuclear genome are sequenced in the hopes that, by comparison with the genomes of nonaffected individuals, a diagnosis might be revealed. (a) What are the strengths and weaknesses of this approach? (b) If you were ordering WES for a patient, would you also include an analysis of the patient’s mitochondrial genome?

A scientist seeks to synthesize a rare human protein in lab. To accomplish this, she utilizes recombinant techniques to insert the DNA of a eukaryotic gene for the protein into bacterial plasmids. These plasmids are transformed into bacteria for expression. She is disappointed to discover that the gene product from the bacteria is not the correct protein. What corrective step could she take in the procedure to fix this issue?

Which of the following statements most accurately describes the action of the enzyme RNA polymerase?Select one  1.) RNA polymerase will transcribe only the exons by skipping over the introns within a eukaryotic gene sequence 2.) RNA polymerase will transcribe both DNA strands, moving in the 3' to 5' direction for one strand and 5' to 3' on the other 3.) RNA polymerase will transcribe both DNA strands, but only one RNA molecule will be used during translation 4.)None of the statements accurately describe the function of RNA polymerase

I only need help with question #8. Use question #7 as context for question #8.

Several common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation.  For example: Rifamycin inhibits prokaryotic RNA polymerase Chloramphenicol blocks the transfer of the peptide from the P to A site. a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible. b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)

Your colleague wants to align the complete sequence of the collagen gene from humans to the homologous complete gene in rats. She can't decide if she should use the alignment program Needle or Water, and turns to you for help. Does it make a difference which program she uses, what advice would you give her?

Can you help me with this question?

What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.

You have two samples you have to sequence: one is a cloned plasmid that you want to verify the sequence of, and another is the cDNA library of the transcriptome of a cell. Which method would you use for each sample and why?

You are screen sharing Here is part of a gene: 5' TTTAATGGTAACCGTATTGCAGCTATTAGCATAAATG 3' AAATTACCATTGGCATAACGTCGATAATCGTATTTAC 5' 3' If the bottom strand of the DNA is the template strand, what will be the mRNA sequence and the amino acid sequence that are present in the protein? Copyright © 2010 Pearson Education, Inc.

After cloning is carried out to insert a foreign gene into BL21(DE3), you would like to confirm the expression of the foreign protein in the bacteria using a blotting technique. Briefly describe the steps to achieve your objective with simple illustrations and descriptions.

What is, The ethical implications of gene editing in humans. 1. Introduction: a) Begin with a captivating opening that introduces the topic and its significance. b) Clearly state the thesis statement in this case 2. Body: a) Start with the first main point that discusses the potential benefits of gene editing in humans. b) Transition to the second main point which focuses on the ethical concerns and risks associated with gene editing in humans. Discuss issues like equity fairness and the potential for unintended consequences such as harmful side effects or genetic discrimination. c) Present counterarguments to your points. Acknowledge opposing viewpoints but refute with logical reasoning and supporting evidence emphasizing the importance of considering potential long-term consequences and the need for strict ethical guidelines and regulations. 3. Conclusion: a) Summarize your main points and restate your thesis statement emphasizing the ethical implications of gene editing in…

Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t copy and paste from Google thank you

There are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).

The enzymes mentioned below are used as tools during cloning, DNA sequencing and/or gene therapy. Explain what they are used for. Also mention the actual biological function of the respective enzymes. 1) RNaseH

During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification

In generating mutations in a bacterial gene involved in antibiotic resistance, a number of point mutations are isolated that render the bacteria sensitive to the antibiotic. You would like to sequence the gene in order to characterize the mutations, but unfortunately, your lab partner just finished the last of the lab's supply of DNA polymerase. The only things at your disposal are materials for performing a western blot, allowing you to visualize the protein encoded by the gene. How would you identify which mutations are likely to be the result of a missense mutation, which are likely to be the result of a nonsense mutation, and which are likely to be the result of a frameshift mutation?

In automated sequencing, you are given a printout of the sense strand of your DNA.  The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space The polypeptide sequence is:

To amplify a section of DNA using the polymerase chain reaction (PCR), all you need to load into the tube is 1) a buffer solution, 2) the DNA you want to amplify, 3) some DNA nucleotides, 4) a polymerase (like Taq polymerase), and O an RNA polymerase a set of forward and reverse primers some phospholipids for a cell membrane some ribosomes