Practice set 8 lecs 14-19

.pdf

School

Binghamton University *

*We aren’t endorsed by this school

Course

501

Subject

Biology

Date

Jan 9, 2024

Type

pdf

Pages

Uploaded by ChefTitanium12870

Practice set 8: Covers lectures 14-19 Complete each set of questions as we advance through the course material. Every question in this exam is connected! PsbS gene is a gene in plants which codes for a protein called “pigment binding protein S that is essential for proper photosystem II functioning. When PsbS is mutated, plants have a much slower rate of growth than is typical. They are “poor growing”. PSBS denotes the normal allele for this gene. psbs denotes the mutated. recessive allele for this gene. Pineapples have 25 chromosomes. PsbS is located on chromosome 22. Also on chromosome 22 and located right next to PsbS. is the gene for spikes. where R represents the allele for sharp spikes and r represents the allele for blunt spikes. Chromosome 21 contains the skin gene, where F represents the allele for tough skin and f represents the allele for soft skin. Questions 1-6 covers lectures 14-15 1. The wild ancestors of pineapples had two copies of each of their 25 chromosomes. Commercially grown pineapples of present day have three copies of each of their 25 chromosomes. What is the correct scientific notation for commercial pineapple chromosome number? a) 25.75 b) 75.25 ¢ 253 d) 325 2. Kiara Jackson PhD is a plant geneticist working for a major university in southern California. She has been tasked with assessing a local farmer’s pineapple crops to find out why 20% of them displayed poor growth this season. Kiara takes samples of the well-growing pineapples and the poor-growing pineapples. Kiara extracts an egg from one well-growing pineapple plant and performs genetic analysis. The egg’s genotype is PSBS/R/f. How did the plant’s chromosomes line up at the metaphase plate? (Assume the well-growing plant genotype is PSBSpsbs. Rr. Ff. In other words. it is heterozygote for all genes.)

A B PS%“S pg}{shs PS%SBSI p% R R B: p: sbs R r R r r r %f %F f% %’z D ¢ | ps! fosbs PSBr 7 sbs R t | | ‘Which two alleles will most likely be inherited in a different combination than in their parent’s chromosomes (recombination)? a) PSBS/psbs and R/t b) PSBS/psbs and F/f Remember that the extracted egg’s genotype is PSBS/R/f. Kiara fertilizes this egg from a random sampling of pollen (sperm) from a male pineapple plant with the genotype PSBS/psbs R/r f/f. In a punnet square of this cross, how many gametic combination of the female’s must be represented? How many gametic combinations of the male must be represented? a) Female: 1. Male: 4 b) Female: 2. Male: 2 c) Female: 4. Male 4: Kiara takes a sample from a different well-growing plant. It also has sharp spikes and tough skin. She doesn’t know its genotype. She mates this plant with one that is poor-growing, has blunt spikes and soft skin. Half of the resulting offspring are well-growing with sharp spikes and tough skin. The other half is poor-growing with sharp spikes and tough skin. What is the genotype of the unknown parent plant? a) PSBSpsbs. RR. FF b) PSBSpsbs. Rr. Ff c) psbspsbs. RR. ff Like humans. pineapple “males™ contain X and Y chromosomes in their diploid cells while “females” will contain two X chromosomes in their diploid cells. There is a gene located on the X

chromosome for skin glow. with B denoting the allele for bright and b denoting the allele for pale. Kiara mates a pale female with a bright male. What kind of glow will their offspring have? a) Half of the females will be bright. half will be pale. All of the males will be pale. b) All the females will be pale and all the males will be bright. c) All the males will be pale and all the females will be bright. Questions 7-20 covers lectures 16-19 7. The normal PSBS gene sequence is 3’ | ATCATGCGCTAATATACG TCGTAATACTGCTCGTTAATCTCGATCTCTAATTCTGCGCGCGCGCG J +1 At what point does RNA polymerase begin transcription (making the mRNA)? a) ATC (far left) b) GCG (far right) ¢ TCG (+1) d) TAC (middle left) 8. Which region of the gene is the termination signal? a) Atthe far 3" end. ATCTAT. b) Atthe far 5° end. CGCGCG. 9. Is the termination signal transcribed info mRNA? Is it eventually translated into amino acids? a) It is not transcribed into mRNA. It is not translated into amino acids. b) It is transcribed into mRNA. It is not translated into amino acids. c) Itis transcribed into mRNA. It is translated into amino acids. 10. What will be the first several ribonucleotides in the sequence of the mRNA that is made? a) 57 AGCAUUAUG 3° b) 3" AGCAUUAUG 5’ c) 5 AUGACGAGC 3’ d) 37 AUGACGAGC 5’ e) 5 UAGUACGCG 3’ f) 3'UAGUACGCG 5’ 11. After the mRNA is made. what occurs? a) Transcription factors binds. b) Methyl groups are added. while aceyl groups are removed. c) Introns are removed. Exons are fused together.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version