BIO230 Self-Guided Annotated Bibliography Assignment

Search (Option + Q) Review View Help Editing v B IU ev Av A =<而< 面 三< A Question 16 The full set of different transcripts expressed by a cell is called Proteome Genome Transcriptome Glycome Question 17 One of the major drawback of using Microarray over RNA sequencing for high throughput sequence analysis is allows quantification of transcripts over five orders of magnitude usei to identify new transcripts and alternative isoforms RNA-Seq is sensitive and offers a way of profiling transcripts of single cells a significant amount of input RNA is required Question 18 Which of these statements are not true for the DNA libraries: Genomic DNA libraries are collection of cloned DNA fragments representing the genome from an organism. Genomic DNA is completely (fully) digested with restriction endonuclease. Complementary DNA (CDNA) libraries are derived from reverse transcribed RNA Genomic DNA is partially digested with restriction endonuclease.

Which sequence variations are identified by NGS and in which format they are store Discuss in details the software used to identify the effect or nature of these variants. How this information can be used for personalized medicine.

how do i expand this into 1000 words The methodology employed to identify differentially expressed genes (DEGs) in breast cancer using RNA-Seq data involves several systematic steps integrating data retrieval, analysis, normalization, DEG identification, and functional annotation. Initially, raw RNA-Seq data is retrieved from the NCBI GEO database, specifically from dataset GSE216238 (Nakshatri, 2023), which encompasses samples from both breast cancer and normal tissue. Subsequently, the raw data was imported into Excel for initial analysis, leveraging its widespread availability and user-friendly interface. Gene expression data for breast cancer analysis was obtained from the Gene Expression Omnibus (GEO) database. The GEO homepage (https://www.ncbi.nlm.nih.gov/geo/) was accessed, and the "Query & Browse" tab was selected. Advanced Search: Under "Search GEO DataSets," an advanced search was conducted (https://www.ncbi.nlm.nih.gov/gds/advanced). Keywords "breast" and "cancer" were…

Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question What are the drawbacks/disadvantages/unknowns associated with this genetic process?

Please answer the question attached  thank you

Please help me with the question below - it is linked to developmental biology/genomics. Please be as brief and concise as possible, while being sure to completely answer the question.

Search (Option + Q) rences Review View Help Editing v A^ Dv A A A Question 1 During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 10 IV 12 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive

personal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... O Search (Option + Q) Review View Help Editing v A BI U Ov =<=v 三 v ... Question 13 Zinc finger nuclease is a Gene editing tool: which uses a site-specific endonucleases containing a DNA-cleavage domain and a modular DNA-binding domain RNA-guided endonucleases programmable nucleases Exonuclease Question 14 Which elements are required for DNA to behave as a chromosome in yeast cells: a centromere an autonomous replicating sequence two telomeres Antibiotic selection marker Question 15 A series of such clones where the insert of each clone partially overlaps that of its neighbors with no gaps is known as a Clone Contig DNA fingerprinting A tiling path Genome MacBook Pro

Which BLAST program should we use in this case? (HINT, what type of sequence are you provided with?)

Please answer as comprehensive as possible.

Please solve and answer in complete sentences. (thank you) Sequence divergence vs conservation for exon vs introns, and peptides A, B, and C of the CDS. for pig (Sus scrofa) vs. us (Homo sapiens). Comparing the (unprocessed) mRNA

ME History Bookmarks Profiles Tab Window Help ucture.com/courses/47420/quizzes/225324/take Question 3. Choose the best method (from lectures 19-21) for each of the following experiments. You want to determine the transcriptomic response to heat shock in [ Choose ] a normal cell line. You'want to measure the quantity of mRNA of your gene of interest in sepal vs petal cells. [ Choose ] You want to identify the mutation that has occurred in your gene o V [ Choose ] interest after EMS mutagenesis. CRISPR Map based sequencing or whole genome shotgun sequencing You want to know the DNA sequence of all of the genes in a Recombinant DNA genome. Restriction enzyme digest RT-PCR or qPCR You want to make large quantities of DNA of your gene of interest from a tiny amount of DNA. Sanger sequencing PCR You want to determine the differences between the proteins made Cloning in the sepal vs petal cells. Microarray or RNA-seq Proteomics Question 12

I only need help with question #8. Use question #7 as context for question #8.

how do i expand this into 1000 words for a result section of a report   The objective is to interpret the results of an RNA-Seq analysis to identify differentially expressed genes in breast cancer using figure 1. The data provided includes gene symbols, chromosome location, start and end points, strand, fold change, log2 fold change, p-value, and false discovery rate (FDR). The RNA-Seq analysis has identified several genes that are differentially expressed in breast cancer. These genes are located on various chromosomes and have varying levels of fold change, indicating the degree to which their expression levels differ between normal and cancerous cells. The gene with the highest fold change is EYA4, located on chromosome 6, with a fold change of 3604.4176. This indicates that the expression of this gene is over 3600 times higher in cancer cells compared to normal cells. The log2 fold change is 11.81555, which is a measure of the magnitude of the difference in gene expression. The…

Please answer these two, please, please pleaseeee

From the results of your BLAST search you can link to the GENE entry for one of your top hits. This link is located under the “Related Information” heading at the right hand side of each displayed alignment (i.e. scroll down to the “Alignments” section). QUESTION What is the “Official Symbol” and “Official Full Name” for this gene?

Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?

Can I please get help on proposing the next experiment (future direction) for the information provided below? One potential next experiment?  Reference: MicroRNA-9 regulates neural apoptosis in methylmalonic acidemia via targeting BCL2L11

Molly RHIT has been asked by the medical staff director to prepare a presentation for the medical staff describing the purpose of coding. Briefly describe what should be included in the presentation.

PLease help, double and triple check your answers, im using this to study, these questions are NOT graded they are PRACTICE problems

Please answer

Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question Describe the molecular genetics process using proper scientific terminology. Describe the steps that are involved. How is it performed?

Enumerate the steps involved in gene cloning and the protein/enzyme requirements for each step. Just put the short but concise answer and kindly avoid plagiarism. Thank you.

D e f g

Read the images attached before answering the following question. Explain the meaning of the numbers and letter in the chromosomal location for gene A.

what is the main purpose of performing the bioinformatics analysis of 16s rRNA genes lab?

how do i expand this into 1000 words The objective is to interpret the results of an RNA-Seq analysis to identify differentially expressed genes in breast cancer using figure 1. The data provided includes gene symbols, chromosome location, start and end points, strand, fold change, log2 fold change, p-value, and false discovery rate (FDR). The RNA-Seq analysis has identified several genes that are differentially expressed in breast cancer. These genes are located on various chromosomes and have varying levels of fold change, indicating the degree to which their expression levels differ between normal and cancerous cells. The gene with the highest fold change is EYA4, located on chromosome 6, with a fold change of 3604.4176. This indicates that the expression of this gene is over 3600 times higher in cancer cells compared to normal cells. The log2 fold change is 11.81555, which is a measure of the magnitude of the difference in gene expression. The p-value for this gene is extremely low…

You are screen sharing Here is part of a gene: 5' TTTAATGGTAACCGTATTGCAGCTATTAGCATAAATG 3' AAATTACCATTGGCATAACGTCGATAATCGTATTTAC 5' 3' If the bottom strand of the DNA is the template strand, what will be the mRNA sequence and the amino acid sequence that are present in the protein? Copyright © 2010 Pearson Education, Inc.

וןווד ← Q Lab Report 6 worksheets 314 F22 .DOCX File Edit View Insert Format Tools Help A 100% ¿ Summary Grades for Arysta Visser: 23 x M Uh-oh! There's a problem w X b The restriction EcoRI cleaves X + Untitled spreadsheet - Goog X https://docs.google.com/document/d/1mKY1HIgMPRh1kRDCmX7msBF2yf07-ogT/edit Outline Headings you add to the document will appear here. Normal text Times ... 12 + B I U 2 18. The restriction EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3', the restriction enzyme HindIII cleaves at the sequence 5'-AAGCTT-3', and the restriction enzyme BamHI cleaves at 5'GGATCC-3. An 805 bp circular plasmid is digested with each enzyme individually and then in combination, and the resulting fragment sizes are determined by means of electrophoresis. The results are as follows: 1 Restriction Enzyme(s) EcoRI BamHI HindIII EcoRI and BamHI EcoRI and HindIII BamHI and HindIII 3 Practice ====•=•€ EX Fragment lengths (base pairs) 430 bp, 375 bp 470 bp, 335 bp Lab Report 6…

Briefly explain this Statement "Treatment for the genetic disorders by using gene therapy " Please answer at your own words, please (400-500 words).