Assignment_3_ANS

List the “gold standard” taxonomic methods currently applied to species designation

Remembering the order of the taxonomic system from Domain to species is something you will need to know. One method to memorize a list is to use a Mnenomic device. The two best devices for taxonomy are either an Acronym or an Acrostic. Please see this link OR ask instructor if you need help on this! Examples of Mnemonic devices   What is your Mnemonic device for the following list (in this order)? Domain  Kingdom Phylum Class Order Family Genus Species

How to interpret this phylogenetic tree (Maximum Likelihood)?

I can apply the knowledge of Basic Taxonomic Concepts  and Principles, Description, Nomenclature, Identification, and Classification.  Characteristics of a Specific Taxon Relative to other Taxa by?

Please help Write a short sentence summary about taxonomy (1-3 sentences) from the video below. https://m.youtube.com/watch?v=F38BmgPcZ_I

5) List the different levels of the taxonomic classification system, in the order of most inclusive to least inclusive: 6) When I was in college, I was taught a mnemonic (memory device) to remember the proper order of classification levels: Drunken Kings Play Chess On Fine-Grained S ? Create a mnemonic of your own that lists the levels in the order in which you listed them in question #5:

Directions: For the following organisms below, you are to sort them into at least 4 different groupings. There must be at least 2 organisms in a grouping. You may place them into columns (in a chart of some sort) or simply Number or your groups and list the organism that are included. ALSO, you must include a written description (at least 2 sentences) describing the characteristics of EACH GROUP that apply to all organisms within that group.   Hint** A quick google search, or image search may provide you the visual data you need to categorize the organisms.   Sponges (Porifera) Cnidarians (Cnidaria) Comb jellies (Ctenophora) Flatworms (Platyhelminthes) Ribbon worms (Nemertea) Nematodes (Nematoda) Arrow worms (Chaetognatha) Segmented worms (Annelida) Sipunculans (Sipuncula) Molluscs (Mollusca) Arthropods (Arthropoda) Bryozoans (Bryozoa) Phoronids (Phoronida) Lamp shells (Brachiopoda) Echinoderms (Echinodermata) Hemichordates (Hemichordata) Chordates (Chordata)

What changed would our scientific community experience without without a taxonomic naming system?

Soalan / Question 3 a) Berikan fungsi utama kekunci dikotomi. Give the main function of dichotomous key b) Kenalpasti langkah-langkah untuk identifikasi spesis berdasarkan kekunci dikotomi. Identify steps for species identification based on dichotomous key. c) Berdasarkan kladogram pada Rajah 1, terangkan secara ringkas ciri-ciri pada label (i), (ii) dan (ii) Based on the cladogram in Figure 1, briefly describe the characteristics on (i), (ii) dan (ii) label. Conifers Lilies Mosses Ferns (outgroup) (ii) (ii) Node (i) Rajah / Figure 1

Please answer all (6)

With the given name/s or situation, identify the appropriate rule or  principle that must be or was considered.   Choices:  Principle of binomial nomenclature, principle of priority, principle of coordination, principle of the first reviser, principle of homonymy, principle of typification When Rattus as a genus name was established, its species name, Rattus  norvegicus was also automatically established.  Noctua Linnæus, 1758 (Lepidoptera) and Noctua Gmelin (Sauropsida)  Limax maculatus was established in 1837 by Nunneley. However, it was  found that Wiktor has already established Limax maximus (Gastropoda)  in 1758. Since L. maximus was the senior synonym, it takes precedence  over L. maculatus and it was used for the species.   The species name of giraffe is Giraffa camelopardalis.

Please explain in 10 sentences or in paragraph form. Please. Thank you in advance!

elaborate the instruction for part V.

This is not a writing assignment.

FILL IN THE TABLE BELOW BY CLASSIFYING INFORMATION WRITTEN IN AN ENVELOPE WITH A RECIPIENT'S ADDRESS. (SEE THE PICTURE) Domain      Kingdom        Phylum           Class             Order                Family                   Genus                      Species

Explain the advantages and disadvantages of using a model organism (include at least 3 of each). Edit View Insert Format Tools Table -| BI U AVe A v &v T? v 12pt v Paragraph v

Please help to creating parsimonious treesFor the following DNA sequences determine the most parsimonious phylogeny. Tree ASpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AATGTCGGGATATATCGCGGGGAAATTTACGACTSpecies 3 AATTGCGGGATATATCGCGGGGAAATTTACGACT Tree BSpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AACTGCGGCATATATCGCGGGGAAATTAACGACTSpecies 3 AAGTGCGCCATATATCGCCCGGATAATTTCGAGA Tree CSpecies 1 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 2 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGCSpecies 3 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 4 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGC Tree DSpecies 1 GGGATATAGCGCACGATATCGTAGCCTAACGTTTTACGSpecies 2 GGGATATAGCGCACGATATCGTAAGCTAACGTTTTACGSpecies 3 AAAATATAGGCGTGGATATCGTAGCCTAACGTTGCATTSpecies 4 GGGATATACCGCACGTTATCGATCCCTAACGTTTTACG

Sequence data from OTUs are provided in the table below with values provided as (percentage distance x 1000) measurements. Determine the phylogenetic tree from the data in the table below using the UPGMA procedure mentioned in class. Berenstain Bear Berentstain Bear Care Bear Gummi Bear Paddington Bear Care Bear 160 Gummi Bear 150 40 Paddington Bear 80 130 120 Place each OTU in the correct box on the appropriate tree below. Do not label the incorrect tree. Care Bear Gummi Bear Berenstain Bear Paddington Bear

A certain morphological trait is used to construct a phylogenetic tree of three species (1, 2, and 3). Match each scenario with the correct corresponding tree. Species 1: No Species 2: Yes 1 1. 2 Species 3: Yes 3 Species 1: Yes 3 2. Species 2: Yes 2 1 Species 3: No 1 3. Species 1: Yes 3 2 Species 2: No Species 3: Yes Review Stuff Question 26 (Mandatory) (4 points) Species diversity is sometimes maintained or facilitated by... (CHOOSE ALL THAT ARE CORRECT). ر 8 DII 8 A 510 E F11 3 € F12

A. Basic Phylogenetic Tree Construction: Create a phylogenetic tree which best represent the data provided: Species Enzyme 1 Enzyme 2 Enzyme 3 Enzyme 4 Guinca pir present present albsent present Camel alosent absent present absent Capvbara prescnt present absent present Species Enzyme 1 Enzyme 2 Enzyne 3 Enzyme 4 Opusurn present presenl pnesent present Plalypus ppresent present pnesent alsennt Chit ken prment atrent ataent atrsent B. Encircle Monophyletic groups that can be found in this tree. Angus cattle White-tailed deer Blue whale Pygmy hippopotamus Extinct Wild boar Mammal Alpaca Based on the phylogenetic tree above, what species is most related to the blue whale?

In minimum of 25 sentences, explain the concept of mimicry in relation to taxonomy and why it is important in the study of insect taxonomy. Provide a clear explanation and provide examples.

Visit a specific area in your school or at home (e. g. garden). Using a pen and a clean sheet of paper, list down five (5) organisms found in that area and describe the value of each organism. Then, classify the value of the organisms by putting a check mark (/) on the space under the correct column. An example has been given. If you think that an organism has more than one value, put a check mark (/) on each.

Activity 1.1: I Can Relate Direction: Complete the graphic organizer below by relating each term to the main idea or word. You may use a separate sheet of paper for your answers. 1. Deoxyribonucleic acid (DNA) 6. Structure 2. Taxonomy SYSTEMATICS 5. Binomial 3. Classification nomenclature 4. Diversity

For Meal Worm This should include a header, in-text citation and give the reader background on the relevant science (the species, life cycle, habitat/niche of each stage, and metabolism.) Site your sources. Roughly 1-2 pages, 1.5 spacing, Avoid saying: GROW, PROVE, IN THIS EXPERIMENT Can you please please answer I really need it please at least try to answer it’s very important please thank you

Based on the information from the following table and the provided phylogenetic tree, what kind of species classification is shown? A B C D E F G H 1 J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L r T Pits) or Tubercles E P P T T T T T P P P P P Р P P O Phenetic Species Concept O Blological Species Concept O Phylogenetic Species Concept O Sympatric Species Concept Blayple (OUTGROUP) beaver Dan, AZ -Twentynine Paime, CA -Harkavilla, UT D-Chilchinbio, NM -Vermilion Cas. AZ 64 -F-Mone Lake, CA -G-Coral Pink Danes, UT H-Pyramid Lake, N -Crescent Dunes, MV Meno Lake CA -K-Olancha CA -Olancha, CA --Winnemucca, NV -El Mirage, CA Lo-Dumont Dunes, CA Form of dorsal ridges M₁ M₁ FFFFFFFFFF M Ma M₂ M₂

1.)List the levels of taxonomic hierarchy from Species to Domain:   2.)What levels are used in binomial naming system (scientific name)? What is the proper notation? Provide an example.

Define the term taxonomy.

A. Basic Phylogenetic Tree Construction: Create a phylogenetic tree which best represent the data provided: Species Enzyme 1 Enzyme 2 Enzyme 3 Enzyme 4 Guinea pig present present absent present Camel absent absent present absent Сарybara present present absent present Species Enzyme 1 Enzyme 2 Enzyme 3 Enzyme 4 Opossum present present present present Platypus present present present absent Chicken present absent absent absent

1) For each of the organisms in the following table, complete the empty columns with an appropriate answer for each taxon. Organism Green Algae Fungi Archaea Sister Taxa Derived Trait Ancestral Trait Mode of Reproduction

Antonie van Leeuwenhoek was the first person to use a microscope and describe tiny animalcules. What is an animalcule? Describe major characteristics of an animalcule in terms of microbiology. Describe the size and living state of these animalcules. Please include: How are animalcules classified/identified? How do you form these classification groups? Edit View Insert Format Tools Table 12pt ✓ Paragraph B IU А VT² V ⠀

Asap

ny - Presenta... Suggested Sites Real-time HTML Edi. 2. Practicing Binomial Nomel Use the classification tables below to write the scientific name correctly for each organism. 8. 9. 10 Common chimpanzee Kingdom: Animalia Phylum: Class: Order: Family: Genus: African Bush Elephant Kingdom: Phylum: Class: Order: Family: Sloth Animalia Chordata Kingdom: Phylum: Class: Order: Family: Animalia Chordata Mammalia Xenarthra Chordata Mammalia Mammalia Proboscidea Elephantidae. Loxodonta africana Primates Hominidae Bradypodidae Bradypus tridactylus Pan Genus: Genus: Species: troglodytes Species: Species: 9. 10.

Can you please enumerate and explain how pesticides and Antibiotic Resistance Affect Genetic Diversity in Aquatic Organisms? Please help me, I'm cramming for the presentation tomorrow. I'm a working student. just out from work.

A taxonomist discovers a plant species that is unknown to science. Using your knowledge of the science of taxonomy gained through this course, discuss in a short essay how this taxonomist can go about describing the new species, and what would be important to do during this process.   You need to mention: Resources where he/she/they can study the plant and other plant collections, species concepts, taxonomic evidence that can be used and how these can be analysed, type specimens and also nomenclature (what is necessary for him/her/them to publish the name).

Please help me answer this through an essay. Please clear handwriting.

Describe the methods/procedures in naming new taxa.