Lab 1 (Jan 16_19) - COMP-1001-001_002_003_056 (Intro to Programming & Laboratory)

6:40 Back Assignment Details Object Oriented Programming Student first_name : string last_name: string id: int gpa : double major: string + set(): void + print(): void Sample Run (User input in bold): Student Information Database First Name: Elaine Last Name: Benes ID: 1961 GPA: 4.0 Major: French_Literature First Name: George Last Name: Costanza ◄ Previous Submit Assignment Dashboard Calendar 7 To Do C Notifications LTE 264 Next ► Inbox

2. First Even Road by CodeChum Admin I've been newly assigned as the city's road planner but this job seems tougher than I thought!   Almost all of the roads in this city are uneven. To fix these, I need to find an even road as a reference. Fortunately, the mayor told me that there's 1 even road somewhere and if I persevere, I could find it.   Could you please help me with this?   Instructions: Your task is to ask the user for the number of rows and columns of a 2D array. Then, print the row number of the row where the sum of all of its elements is even. For this problem, it is guaranteed that there is one and only one such row. Input 1. Number of rows 2. Number of columns 3. Elements of the 2D array Output Note that the row number starts at 0, not 1. Enter # of rows: 3 Enter # of columns: 3 Enter elements: 2 7 4 1 1 2 0 5 0   Even row: 1

2. First Even Road by CodeChum Admin I've been newly assigned as the city's road planner but this job seems tougher than I thought!   Almost all of the roads in this city are uneven. To fix these, I need to find an even road as a reference. Fortunately, the mayor told me that there's 1 even road somewhere and if I persevere, I could find it.   Could you please help me with this?   Instructions: Your task is to ask the user for the number of rows and columns of a 2D array. Then, print the row number of the row where the sum of all of its elements is even. For this problem, it is guaranteed that there is one and only one such row. Input 1. Number of rows 2. Number of columns 3. Elements of the 2D array Output Note that the row number starts at 0, not 1.

2. First Even Road by CodeChum Admin I've been newly assigned as the city's road planner but this job seems tougher than I thought!   Almost all of the roads in this city are uneven. To fix these, I need to find an even road as a reference. Fortunately, the mayor told me that there's 1 even road somewhere and if I persevere, I could find it.   Could you please help me with this?   Instructions: Your task is to ask the user for the number of rows and columns of a 2D array. Then, print the row number of the row where the sum of all of its elements is even. For this problem, it is guaranteed that there is one and only one such row. Input 1. Number of rows 2. Number of columns 3. Elements of the 2D array Output Note that the row number starts at 0, not 1. Enter·#·of·rows:·3 Enter·#·of·columns:·3 Enter·elements: 2·7·4 1·1·2 0·5·0 Even·row:·1

Python Programming Please use only numpy no other library like cv2 Or any other Write a python program that doesn't use any special libraries aside from numpy that takes an image.raw and performs histogram equalization and then exports it as a raw image

Python Programming Please use only numpy to export image no other library cv2 , pil Or any other Write a python program that doesn't use any special libraries aside from numpy that takes an image.raw and performs histogram equalization and then exports it as a raw image

python programming language

G thresh skin x O Chrye Hist x M x Ge3/0-Goo x D Account Sur x m GMA Redire X My McDs A x Descr https://universityafmanitoba.desire2learn.com/d2/e/content/321335/viewContent/1510469/View The gear ratio (R) of a bike is calculated as the quotient of the chainring over the cog size: chainring teeth cog teeth R= Distance per wheel turn You can calculate the distance covered by one complete revolution of the wheel by calculating the circumference (e) of the wheel: e = wheel size x # Gear development Depending on the gear ratio, the cog (and Ihus rear wheel) are going to spin completely around several times for each turn of the chainring. This measurement is called the "gear development d, and is calculated as: d= exR Gear inches A gear inch is a relative measurement of the mechanical advantage of different gears. A low value for gear inches is an "easy" gear, and a high value for gear inches is a "hard gear. Gear inches, as the name implies, is calculated in inches: gear inches di x R…

Scenario Instructions You are a Mathematics major who has agreed to teach an elementary school math class where the students are studying geometry. They are just starting to learn about sine, cosine, and tangent. You've decided that you want to show the students what these functions look like when they have been graphed. Write a Python program to display three separate graphs for sin, cos, and tan. Add the ability to show all three graphs on a single graph with one row and three columns.

5. Lemniscate or figure 8 You should have learned lemniscate or the famous figure 8 in high school as well. The following is a snip from Wikipedia. Lemniscate of Bernoulli From Wikipedia, the free encyclopedia In geometry, the lemniscate of Bernoulli is a plane curve defined from two given points F1 and F2, known as foci, at distance 2c from each other as the locus of points P so that PF₁·PF₂ = c². The curve has a shape similar to the numeral 8 and to the ∞ symbol. Its name is F2 P A lemniscate of Bernoulli and its two foci F₁ and F2 Figure 8. Write a computer program (with graphics and GUI parts) that draws the figure 8. Show your analysis if applicable (which means any equation?). 9

A testnavclient.psonsvc.net/#/question/2896870d-7203-41a3-a0c3-e2d6bace85a5/34c0be18-53a8-4234-b085-4759c8. Review - A Bookmark Quiz 6P1.3 Sound Waves (COPY) / 8 of 13 Which choice best identifies media through which sound can travel? A. vacuums and liquids B. solids and outer space C. gases and outer space D. solids and liquids X

Computer Science - Programming Languages and Compilers Natural Semantics   https://docs.google.com/document/d/1iEI9hGkgLgdbZ4BkcuGmHi-mIirL1X0w6dtqgYHFl1o/edit?usp=sharing   Link has all the instructions needed   thank you

Background and formula: Ellipse has two types of axis - Major Axis and Minor Axis. The longest chord of the ellipse is the major axis. The perpendicular chord to the major axis is the minor axis, which bisects the major axis at the center as shown in Figure 1. Ellipse is different with circle which has only one radius. There is no simple formula to calculate the exact or accurate value of perimeter of an ellipse. Therefore, we use approximation formulas to calculate the approximate value of an ellipse's perimeter. One of the approximation methods is called Ramanujan Formula as follows: p zn[3(a+b) – Г(За + b) (а + зь)| where a is the semi major axis and b is the semi minor axis of the ellipse, respectively, as shown in Figure 1. be major axis Figure 1. Ellipse The problem An input file, data.txt has the following information: data.txt 4 3 8 4 3 2 7 Write a complete C++ program that read the values of major axis and minor axis from input file, data.txt; and then compute its perimeter…

Background and formula: Ellipse has two types of axis - Major Axis and Minor Axis. The longest chord of the ellipse is the major axis. The perpendicular chord to the major axis is the minor axis, which bisects the major axis at the center as shown in Figure 1. Ellipse is different with circle which has only one radius. There is no simple formula to calculate the exact or accurate value of perimeter of an ellipse. Therefore, we use approximation formulas to calculate the approximate value of an ellipse's perimeter. One of the approximation methods is called Ramanujan Formula as follows: p z n[3(a + b) – (3a + b)(a + 3b)] where a is the semi major axis and b is the semi minor axis of the ellipse, respectively, as shown in Figure 1. b (major axis data.txt 4 8 5 7 Write a complete C+ program that read the values of major axis and minor axis from input file, data.txt; and then compute its perimeter using the Ramanujan Formula. The first column in the input file is the major axis, while the…

Credit card numbers follow certain patterns: It must have between 13 and 16 digits, and the number must start with:■ 4 for Visa cards■ 5 for MasterCard credit cards■ 37 for American Express cards■ 6 for Discover cards In 1954, Hans Luhn of IBM proposed an algorithm for validating credit card numbers. The algorithm is useful to determine whether a card number is entered correctly or whether a credit card is scanned correctly by a scanner. Credit card numbers are generated following this validity check, commonly known as the Luhn check or the Mod 10 check, which can be described as follows (for illustration, consider the card number 4388576018402626): 1. Double every second digit from right to left. If doubling of a digit results in a two-digit number, add up the two digits to get a single-digit number. 2. Now add all single-digit numbers from Step 1. 3. Add all digits in the odd places from right to left in the card number. 4. Sum the results from Steps 2 and 3. 5. If the result from…

Question 9 The postfix equivalent of mathematical expression 9x(5-(3+6)) is the expression + 36 - 5 x 9 the expression x 9 -5 + 36 the expression 9 5 3 6 + - x the expression 6 3 + 5 x 9- arch

python programming (turtle) question

Plot artificial intelligence  Python You have to write code

Topics: Graph Data Structures, Depth-First Search, Breadth-First Search, Dijkstra’s Algorithm, Bellman-Ford Algorithm, Kruskal’s Algorithm, Prim’s Algorithm, Quick Find, Quick Union, Weighted Quick UnionTO DO: Create a Python Program that satisfies all the testcases Since an electronic circuit is the interconnection of several components, it might not be surprising that they can be represented as graphs which allow our computers to simulate the behavior of the circuit. A sample resistor network has its corresponding netlist representation used in ngspice (see Figure 1). Description: This problem focuses on properly parsing the input. To test this, your code should be able to properly store each input resistor and store them in a data structure and representation of your choice. To verify this, your code should be able to identify which resistors are in series and which resistors are in parallel. In the context of a graph, two resistors can be considered in series if there are no…

Please add an gif image/plot an gif to this code. This is a brownian motion python code  here it is code  import numpy as np import matplotlib.pyplot as plt def brownian_motion(L, N):    # initialize position in the center of the grid    x = L // 2    y = L // 2    # initialize the grid    grid = np.zeros((L, L), dtype=np.int32)    # loop over the number of steps    for i in range(N):        # choose a random direction        direction = np.random.choice(['up', 'down', 'left', 'right'])        # move one step in that direction        if direction == 'up':           " y += 1"        elif direction == 'down':            "y -= 1"        elif direction == 'left':            "x -= 1"        elif direction == 'right':            "x += 1"        # make sure the particle is still on the grid        if x < 0 or x >= L or y < 0 or y >= L:            "continue"        # update the grid        grid[y, x] = 1    return grid if __name__ == '__main__':    # set the size of the grid    L…

computer graphics simple utilty curvewrite c#.net and send the designi need same link design and code and output please curve and i need to input the Coordinates https://www.codeproject.com/Articles/5267642/A-Simple-Utility-for-Drawing-Function-Curves

python programming: Topic: Functional model Write a program one statement long (it can span multiple lines) that displays the curvature of a sinusoid.

Python language    What is an f-string, and how can it be used when printing information to screen? (hint, show an example of how an f-string can be used to print the value of x to screen)

Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…

Decrease-by-Constant-Factor Fake-Coin puzzle method in Java or C++ to find the fake coin out of n coins. Assume the false coin is lighter. Randomly place the false coin among the n coins. Submit results images and code files.

Help with Python Turtle: Need help finalizing turtle drawing and to be fixed. I've included an picture to show what I need for the code to resemble.1. Lowering top circles to the middle of the canvas to be able to view the WHOLE island.2. The possibilities of the circles being more irregular when generating.3. Rivers being bold/thick and cutting through the island on a diagonal. Previous question: https://www.bartleby.com/questions-and-answers/help-with-python-turtle-struggling-with-last-few-steps-to-complete-what-i-want-the-following-1.-make/41857550-b5f1-46eb-95e1-dc46d2033b37 The code:import turtleimport randomimport tkinter as tkfrom tkinter import simpledialogfrom PIL import Image # Define colorsocean = "#000066"sand = "#ffff66"grass = "#00cc00"lake = "#0066ff"mountain_color = "#808080"  # Gray color for mountains # Store mountain positionsmountain_positions = [] def draw_irregular_circle(radius, line_color, fill_color, irregularity=10, spikeyness=0.2):…

it is not a quiz it is a homework i don't know how to solve it

Select the answer choice that most closely satisfies the inquiry.Programs in this category include word processors, spreadsheet editors, e-mail clients, and web browsers.

Programming language C#

Computer Science GIS Cartography Question: Name a couple of ways you could lessen the number of colors used in a class-type map.

Using C++ language create the program for the image below

Software used is Visual Basic.

Computer organization and assembly language   I need help with writing the " Methodology" section PLEASE. Just the Methodology Please and thanks!   I will paste the Introduction that I did down below: Introduction The Hamming code as we know it has a long history. The Hamming Code technique was developed by American Mathematician Richard W. Hamming to detect errors and correct them. Mr. Richard published a paper in 1950 in which he introduced a concept of the number of positions in which two code-words differ and the number of changes required to transform one code-word into another. It is now popularly known as Hamming distance. After this study, Hamming created a family of mathematical error-correcting codes, which today we called Hamming codes. This landmark study not only solved an important problem in telecommunications and computer science, but it introduced a whole new field of study. He created the Hamming Code which is still commonly used today in applications such as ECC…

pizza (python)Mario owns a pizzeria. Mario makes all of his pizzas from 10 different ingredients, using 3 ingredients on each pizza. Mario’s cousin Luigi owns a pizzeria as well. Luigi makes all his pizzas from 9 ingredients, using 4 ingredients on each pizza. Mario and Luigi have made a bet: Mario believes that customers can order a larger selection of pizzas in his pizzeria than they can order in Luigi’s pizzeria. Use functions for this assignment. Implement a factorial() function yourself (do not use the one from the math module) When choosing k items from n possible items, the number of possibilities can be obtained using the following formula: (??)=?!?!(?−?)!(nk)=n!k!(n−k)! Make a function called choose with two parameters n and k, that implements the above formula. Write a program that calculates the number of pizzas Mario and Luigi can make. The outcome should look like this: Mario can make 120 pizzas.Luigi can make 126 pizzas. Luigi has won the bet.