Lecture2_WhyBehavior_23Aug

.pdf

School

Indiana University, Bloomington *

*We aren’t endorsed by this school

Course

103

Subject

Psychology

Date

Oct 30, 2023

Type

pdf

Pages

48

Uploaded by AmbassadorAnt2735

Report
Please sit near someone new
Last time Introductions, note cards Syllabus overview Top Hat practice Today’s topics What is an animal? What is behavior? Why study behavior? Scientific Method Anthropomorphism
Hi! My name is Amalia. What’s yours? Meet and greet again! (with a different person)
What made your previous courses successful (or not) for you? With your neighbor(s), reflect upon the best and worst classes you have taken in your major/related fields What actions will you need to take to do well in this course? What actions would you like to see taken by me?
Other notes Check your email & Canvas frequently (preferably every week day) In-class participation will be assessed via Top Hat or worksheet you turn in (see syllabus for details including # you can miss) More info. on your two assignments to come…
Top Hat question Why are you taking this class? (i.e., What do you hope to get out of this class (besides a good grade)) ?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help

Browse Popular Homework Q&A

Q: Three small but dense objects are located in the x-y plane as shown in the figure. The objects have…
Q: What is the function of carbonic anhydrase? a. To catalyze the interaction of carbon dioxide with…
Q: The following table shows the distribution of murders by type of weapon for murder cases in a…
Q: 1) You learned that light is an electromagnetic wave that can travel through a vacuum. Can sound…
Q: Set up the definite integral that gives the area of the region. Y₁ = x² + 2x + 5 Y2 = 2x + 30 -5 dx…
Q: solve for first and second derivative (x2 + 8)2(x − 8)
Q: The sales tax on an item is 4%. Express the cost, c, in terms of the price of the item, p. c = |p(c)…
Q: Which of the following sequences would successfully accomplish the shown synthetic ransformation?
Q: a bookstore owner examines 6 books from each lot of 20 to check for missing pages.If he finds at…
Q: A uranium-238 nucleus undergoes a radioactive decay, 238 U 234Th + 4He. The masses are approximately…
Q: Students at Upscale University are required to take at least 3 humanities and 4 science courses. The…
Q: For the function f(x) = -3ex, find f''(x), f''(0), f''(7), and f''(-9). f''(x) = (Type an exact…
Q: You wish to retire in 30 years, so you begin a 401K program that pays $100 into your account weekly…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
Q: The self-schema is best described as the internal monitor of social acceptance versus rejection. the…
Q: Use the theorem given below to find the curvature. r(t) 2ti + 4 sin(t)j + 4 cos(t) k = Theorem: The…
Q: QUESTION 7 9 What is this a symbol of? O Motor starter coil O Heater Horn O Solenoid valve
Q: The rectangular coordinates of a point are given. Plot the point. (-8√2, -8√2) O ... -15 -10 -5 -15…
Q: (e) Compute the mean μx. Round the answer to two decimal places. Mx X S
Q: 4.26 A single-phase load is supplied through a 34.5-kV feeder and a 34.5/2.4-kV transformer. The…
Q: This is with excel. With a pen and paper, what is the equation to solve this problem. The visuals of…
Q: Find the following matrix product, if it exists. 10 [8] -3-6 7 Select the correct choice below and,…