Definition Of Binary Expression Systems For Regulating Gene Expression

The vital components and techniques of gene cloning are as follows, the DNA sequence that contains the desired gene (EZH2) is amplified by Polymerase chain reaction. PCR was established by Kary Mullis in 1985, popularly known to amplify target sequences of DNA (EZH2) to a billion fold in several hours using thermophilic polymerases (Taq) ,primers and other cofactors (Sambrook and Russell, 2001). Three crucial steps are involved which are Denaturation (at 95°), Annealing of the forward and reverse primers (55-65°) and lastly primer extension (at 72°). After amplification the desired sequence is integrated into the circular vector (pbluescript) forming the recombinant molecule. For the compatibility of the insert and vector, both were digested with (EcoR1) so the same cohesive ends are generated in both, making it easier to ligate. EcoR1 is a restriction enzyme that belongs to the type II endonuclease class which cuts within dsDNA at its recognition site “GAATTC” (Clark 2010; Sambrook and Russell, 2001).

Draw a schematic of the vector and include all of the genetic loci that will permit this two-gene vector to function as a shuttle vector between human cells and E.coli cells. (For your convenience, I have put the A and B polypeptide coding regions on the two-gene vector schematic.)

PCR permits the synthesis of millions of copies of a specific nucleotide sequence in a few hours. It can amplify the sequence, even when the targeted sequence makes up less than one part in a million of the total initial sample. Steps of the PCR cycle are shown in below figure.

Translocations can cause strong transcriptional factors to be moved close to a target oncogene which will increase its expression. Or, they can result in the creation of a fusion gene that encodes a novel oncogenic protein.

In the case of AquAdvantage, they have done this with the Chinook Salmon gene and another gene from the Ocean Pout (the gene from the Ocean Pout has antifreeze proteins. They have inserted this into the gene sequence to allow the Atlantic salmon to grow during the winter months when wild Atlantic salmon stop growing). Restriction enzymes are enzymes which cut the gene from a specific recognition site and are used to extract the desired gene out of the DNA molecule. This gives the DNA “sticky ends” which will allow the sequence to later attach into a circular DNA plasmid. The growth hormone gene is then fused with a promoter such as a metallothionein gene, which allows the growth hormone gene to be produced throughout the body. The DNA fragment then goes through a process called ligation, which is where they are reassembled into a DNA plasmid. The sections of DNA with sticky ends are then joined together by base pairing in a process called annealing. If the ends were blunt, they would not properly attach and the engineered gene could fall apart, and they must have matching base pairs to connect too due to the base pairing rule that only certain bases join with certain bases. They

The gel was covered with a buffer and then six samples labeled A-F were deposited into the wells using a micropipette. Three of these samples (A, B, C) were control samples to compare to D, E, and F (the mother, child, and father). The safety cover was placed on the unit and then brought to a power source. The leads were connected the chamber and left for approximately 20 minutes. The agarose gel was removed from the tray and placed onto a sheet of plastic wrap. An Ethidium Bromide card was placed face down onto the gel to stain for approximately 5 minutes. Finally, the card was removed and the gel was placed on top of a UV light. The samples were pushed towards the center due to opposite electric charges. Agarose gel separates the DNA samples by the way they were cut. The restriction enzyme MST II cuts the DNA strand at CC/TNAGG where N is any nucleotide base. If the enzyme recognizes this, it is cut. If it does not recognize it then the strand is left whole. We were able to observe the DNA strands due to them being dyed and placed over a UV light. The control samples were utilized so that the other samples could be compared to test for their genotype. The data was analyzed in this way to differentiate between the different genotypes and the number of bars they

Dr. Tina Henkin’s seminar “Flipping the switch: How cells use RNA to regulate genes expression”, was outlined by four general questions. The first question addressed in the seminar was “Why study Microbes?”. The next, “Why study bacterial gene regulation?”. The third question, “What are the basics of gene expression?”. Finally, “What’s special about riboswitches?”. Dr. Henkin addressed these questions throughout her seminar, which eventually led into to more specific questions of gene expression and predicted hypotheses of her model. However, to understand these more specific questions and predictions it is crucial to understand the first four questions outlined in the beginning of the seminar.

The first thing to do with a situation like this would be to first find out all the needed information about the gene you can. The first important thing would be the size of the gene on the chromosome, because viruses only have a certain amount of DNA/RNA they can hold inside their virus particle. The gene is found on chromosome 20 and is 15,438 bp in length (NCBI). So, the only type of gene therapy vector that would be able to carry a gene that large would be the Herpes Simplex Virus. HSV has a carrying capacity of over 30kb, so this would more than fit the entire length of the gene in the virus particle. It also is a good fit because after looking up information on PRPc, because it is a cell-surface copper-binding glycoprotein expressed

These chemical signals set off a cascade of gene activity in the A. tumefaciens which direct a series of events required for the transfer of tDNA from the plasmid into the plant’s cells through the wounds of the plant. The tDNA then moves into the nucleus of the plant cell and becomes integrated into the plant chromosome (Understanding GMOs).

There are many different EREs in the genome. It is believed that there are approximately 70,000 EREs in the human genome and between 5,000-10,000 of them are considered potentially functional (Dietz & Carroll, 2008). Once transcription is complete, the ligand dissociates from the receptor, causing the receptor to detach from the DNA and to be rendered inactive by binding with heat-shock proteins. Another way that ERs affect transcription is not through EREs but by interfering with other transcription factors. Estrogen receptors will use coactivator or corepressor proteins such as AIB1 or p160 protein family members to modulate transcription without binding to an ERE (Shang, Hu, DiRenzo, Lazar, & Brown, 2000). The variety of co-regulators allows for a high degree of functional specificity.

Then, the desired gene is isolated. If the gene comes from a genome that has already been investigated by scientists, there will be a collection of sections of the genome species ready. If the genome where the gene is taken from is unknown, a much more complicated procedure follows, as the collection isn’t there. Most of the time, the genome type has already been used and experimented with. The Polymerase Chain Reaction is used to amplify, or multiply, copies of a DNA piece. It depends on the ability of DNA polymerase to synthesize strands of DNA complementary

A fragment of DNA was then amplified using Polymerase Chain Reaction (PCR) with a forward primer and a reverse primer. PCR is a technique used to make as many copies as possible of a specific section of the DNA extracted. The five necessities for PCR to be successful is the DNA template that one wants to copy, a buffer, nucleotides (ATCG), polymerase, and primers. PCR occurs in 3 stages: (1) Denaturing, (2) Annealing, and (3) Extending. During the Denaturing stage, the stand containing the DNA template (in this case the fetus’) is heated to separate the double stranded DNA. Next during the Annealing stage, the stand is then cooled to allow the primers to attach to a specific location on the single stranded DNA template (primers are usually 20 to 30 bases long). Lastly during the Extending stage, the stand’s temperature is increased to permit the making of new DNA by a specific DNA polymerase. The result is multiple new strands of DNA that has been successfully copied (What is PCR, WEB), followed by electrophoresis in 1% agarose gel. Electrophoresis is a technique commonly used to separate DNA, RNA, and proteins according to their sizes. The result was then purified with a PCR purification kit (removing any remaining DNTPs, or nucleotides that could result in contamination). The products were

To make it easier to study certain diseases, transgenic animals have been developed to have a particular gene that

For starters, one has to to label three tubes “Rainbow Trout”, “Brown Trout”, and “Common Carp”. Next, insert each DNA sample to where it belongs in each tube. When done, insert Taq and dNTPs tag to each tube. After that, add two different primers (meaning left and right), to each tube: “caaaggcttggtcctgactttacta” and “gttattccaagcgcaccttc” in Raonbow Trout; “caaaggcttggtcctgactttact” and “gttattccaagcgcaccttccg” for Brown Trout; “caaaggcatggtcccgacc” and “ggtttgatccaagtgcactt” for Common Carp. Next, person must put all three tube into the PCR, where they are heated and kept for 3 hours. Later when that is finished, the researchers needs to place a tube one by one into the sequencer to read its sequence. Finally, save the results and analyze

The polymerase chain reaction or PCR for short can be used to create many copies of DNA. This allows the DNA to then be visualized using a dye like ethidium bromide after gel electrophoresis. The process has been refined over the years, however the basic steps are similar.