For Reference Essay

974 WordsApr 2, 20134 Pages
KimNgoc Huynh Bimm101 Section: CO2 TA: Pagkapol Yhew Pongsawakul Bioinformatics Homework#1 Question#1: The sequence is 8654 nucleotides long. Question#2: -10 sequence for the lux operon: 5’-TGTTATA-3’ There are 2 nucleotides different that are G and A. Question#3: The lux R, which has its own promoter and is transcribed in the opposite direction from the lux operon, could not be transcribed from the same strand because the RNA polymerase recognizes a promoter sequence only in the direction of 5’ to 3’, and the lux R gets transcribed in the opposite direction from the lux operon. Thus, the transcriptions of luxR and lux operon have to occur on two different strands including coding strand and template strand. Question#4:…show more content…
In our experiment, we did not digest the lux operon with Hind III because there are 6 Hind III sites in the lux sequence, and it might cut within the gene region of interest, which is luxAB gene in our experiment. Hind III has more sites than Sal I because Vibrio Fischeri is A/T rich (AT=66%, GC=34%) and so is Hind III recognition sequence; thus, there are more chances for Hind III to recognize and cut the lux sequence along with a great possibility of it cutting within the luxAB sequence. Question#6: a) * The position of the forward primers: 4053-4072 The alignment of the forward primer on the lux operon: Lux operon 1 ACGAAGGCAGCCTTAGCATT 20 Primer 4053 ACGAAGGCAGCCTTAGCATT 4072 Score | Expect | Identities | Gaps | Strand | 40.1 bits(20) | 0.072 | 20/20(100%) | 0/20(0%) | Plus/Plus | * The position of the reverse primers: 6379-6398 The alignment of the reverse primer on the lux operon: Score | Expect | Identities | Gaps | Strand | 40.1 bits(20) | 0.072 | 20/20(100%) | 0/20(0%) | Plus/Minus | Lux operon 1 TGGACAGTCATACCCTCTCC 20 Primer 6398 TGGACAGTCATACCCTCTCC 6379 b) Yes, a PCR product produced using these primers will contain the entire luxAB gene sequence because the positions of the forward (4053-4072) and reverse (6379-6398) primers indicate that the PCR will amplify the region from 4053 to 6398 that also
Open Document