Molecular Characterization of Brucella Abortus from Cattle and Buffaloes

There were several steps used to acquire the colony necessary for the PCR. First a student forearm was swabbed using a cotton swab, the cells were then placed in an agar plate. DNA was then extracted from the cultured bacteria by using a technique to lyse the cells and solubilize the DNA, then enzymes were used to remove contaminating proteins. The DNA extraction consisted of a lysis buffer that contained high concentrations of salt for denaturing. Binding with the use of ethanol and a washing step to purify the DNA. The final step for the DNA extraction was elution where the pure DNA was release. Proceeding the extraction of DNA the results of the 16s gene amplification were examined through gel electrophoresis it was analyzed by estimating the size of the PCR bands with marker bands. After measuring the success of the extraction, a technique called TA cloning was started. Cloning of PCR products was done by using partially purified amplified products with

The TARGet website allowed us to determine the Flanking sequence and DNA sequence of the homologous, which we then transferred onto Benchling. The Benchling website helped us determine the introns and exons present in our DNA sequence, as presented in Figure 3. When using benchling we also created primers that cover as various exons and introns as possible. Once we determined the forward and reverse primers that were to be used in our sequence, we ordered them and once received added resuspension buffer according to the instructions on the paper. We then diluted the forward and reverse primers and created yet another PCR table as shown in Figure 4 and once again created another master mix and ran electrophoresis on them. Our results can be seen in Figure 5. We ran the same dilutions a second time to clarify our results for the first PCR reaction. Those results can be seen in Figure

The Blue sample, which was hypothesized to be recombinant, should have produced similar if not identical bands to the known recombinant Green sample, which is not the case in the PCR gel. Instead, the Blue sample shows faint bands more closely resembling the Red sample, known to be non-recombinant. The bands did not show through for the PCR samples which indicates that the PCR preparation was not successful. This is further confirmed when analyzing the positive control which produced no results. The lack of bands in the negative control suggest that failure this portion of the experiment was not due to

Epidemiology: Brucellosis is an extremely rare disease in the United States as a result of veterinary control measures. Currently fewer than 100 cases are reported annually most of which comes from California, Florida, Texas, and Virginia. Most human cases of brucellosis in the U.S. are due to B. melitensis. Internationally,

In order to properly determine the sizes (kilobase pairs) and concentrations (ng/ul) of two unknown DNA samples, several laboratory techniques were performed. Each unknown DNA sample was diluted with 6x buffer in three different volumes, which created six loads in total [1]. AGE was used for DNA fragment separation

800μL of sterile water and 200μL of the DNA isolate were pipetted into a 1mL UV-transparent curvette and mixed well. 1mL of sterile water was added to a second 1mL curvette. On the spectrophotometer, a baseline correction was done and the absorbance spectrum of the DNA isolate was recorded. A PCR master mix was made. 5μL of DNA isolate was pipetted into two new labelled PCR tubes. 5μL of Milli-Q water were pipetted into a third labelled PCR tube. 20μL of the created master mix was pipetted into one PCR tube and 20μL of the given master mix was pipetted into the other PCR tube. PCR tubes were placed in a thermocycler, and then frozen. Tube identification was noted. Electrophoresis Gel apparatus was set up using 1% molten agarose. 3μL of each of the three PCR tubes were pipetted into 3 labelled microcentrifuge tubes. 6μ of sterile water and 1μL of 10x loading dye was added to each. Gel was loaded with samples and a DNA ladder and gel was run. An image was captured and interpreted. Sample with the largest quantity of DNA, was prepared for sequencing. 10μL of

The small amount of colonies were put into a labeled PCR tube which contained: 10 µl GoTaq Master Mix, 1 µl F primer for the SSU, 1 µl R primer for the SSU, and 7µl of H20. The tubes went through a various thermal cycler program. 10min at 95 celsius, 30 seconds at 95 celsius, 30 seconds at 55 celsius, 2 minutes at 72 celsius, and 10 minutes at 73 celsius. The tubes were placed in a refrigerator until gel electrophoresis.

After cell lysis and DNA extraction, 100µl of DNA was stored at -30oC prior to subsequent 16S rRNA PCR and gene sequencing. Universal primers 27F; AGAGTTTGATCCTGGCTCAG and 1492R; GGTTACCTTGTTACGACTT were used to target the 16S rRNA gene. PCR amplification was performed using a thermocycler with the following program: 25 cycles for 5 mins at 94oC, 30 secs at 94oC, 30 secs at 56oC and 90 secs at 72oC. The final elongation step was performed for 10 mins at 72oC. PCR products were analysed by agarose gel electrophoresis (Figure 1) to ensure the appropriate size of the amplification product. The PCR procedures were repeated in the similar manner except adding forward and reverse primer separately. Post PCR products were cleaned using Safodex G-50per the manufacturer’s instructions. Subsequently, the filtered PCR product was collected in fresh microtiter plates and heated at 90oC for 30 mins. The PCR product was submitted to the Ramaciotti DNA Sequencing Analysis Unit, at the School of Biotechnology and Biomolecular Sciences, UNSW for DNA

abortus (as well as other bacteria such as E. coli and S. typhimurium) possess HF-1 an RNA-binding protein that regulates a set of genes which are essential for survival in the stationary phase of their life cycle [2, 3]. A mutation in the hfq gene (which codes for HF-1) of Brucella was shown to result in defective stationary-phase physiology [3]; this mutant was susceptible to acidic pH and free radicals, and also lost its viability more quickly than the wild-type strain. Differential gene expression of the hfq mutant and the wild-type Brucella strain led to the identification of numerous genes that require the HF-1 protein for its optimal expression during the stationary phase [3]. The products of these genes provide defences against various stresses in phagosome. An important enzyme shown to be regulated by HF-1 in the stationary phase of E. coli and S. typhimurium is Stationary phase survival protein, SurE and L-isoaspartyl protein carboxyl methyl transferase, Pcm. Genes for SurE and Pcm overlap and exist in an operon that is essential for the survival of E. coli and S. typhimurium in stressful condition

At least 20 L. major kDNA haplotypes have been identified, by sequence alignment, in comparaison with sequences, presented in GenBank. Only 20 out of 80 (25%) PCR

• Make single-strand cDNA from mRNA – downstream antisense primer or random hexamer and RT to make complete cDNA copy of RNA molecule • Use cDNA, DNA polymerase, and a downstream primer in conventional PCR – extension leads to double-stranded DNA • Regular PCR of dsDNA

These molecular-based techniques have been revolutionised by the discovery of endonuclease enzymes and the invention of the Polymerase Chain Reaction (PCR) in 1983 by Kary Mullis. This technique allows for the rapid cloning of fragments of DNA so that further testing can be carried out and has simplified the process of nucleic acid amplification in vitro (Bartlett and Stirling, 2003). Using a

The IL-10 promoter polymorphism (PCR-Restriction Fragment Length Polymorphism) assay as described by Turneret al(year) is used for detecting the -592 SNP by introducing 2 alleles, A and C (A-C). A measurement of 100 ng of genomic DNA is amplified in a 25 mL and final volume reaction mixture containing 10X KCL buffer, 1.5mM MgCL2, 0.2mM of each dNTP, 25 pmol of each primer, and 1 unit of Taq polymerase was determined. The cycling conditions were determined as follow: first, in 95°C for 5 minutes; and second 35 cycles of 94°C for 40 seconds at 61°C for 1 minand at 72°C for 40 seconds were specified; finally at 72°C for 10 minutes it was determined. The PCR product contains 412 bp and the Restriction Fragment Length Polymorphism assay was performed in a 15 mL reaction mixture containing PCR product (10 mL), buffer (1.8 mL), enzyme (RsaӀ 2 units per reaction), and distilled water (3 mL). The reaction

16S rRNA gene fragment was amplified by PCR using primers 27F and 1492R (Baker et.al, 2003, Frank, et.al 2008). Amplification was performed by 30 cycles (denaturation 95 ° C for 30 s, annealing 55 ° C for 60 s, chain extension 72 ° C for 90 seconds) with an initial denaturation 95 ° C for 3 min and a final chain extension of 72 ° C for 5 min . Taq DNA polymerase enzyme (GoTaq Green Master Mix from Promega) was used for the amplification reaction according to standard usage.

Next step involve DNA sequencing of the cambial-region cDNA inserts. It was performed using PCR products as templates from the 59 end. Microtiter plates were loaded onto a robotic worktable. This worktable is the place where the PCRs, quality control and sequencing reactions performed automatically. How do PCRs performed? By using general vector primers and standard PCR controls