Molecular Genotype Lab

1. List whether the student was positive or negative for each characteristic and include whether the characteristic is dominant or recessive. (6 points)

With these two images, a judgment can be made about STR and Y-STR on an electropherogram. Y-STR results on an electropherogram can be seen on image A. As one may notice, the results of this electropherogram are incredibly clear and lacking in background noise and artifacts. The only artifact that may be seen is at loci D16S539. Although the artifact appears to be stutter, it is incredibly small and unnoticeable. For almost all of the data, a single peak was found within each locus. This made interpretation much easier to observe. Image B, which displays STR, contains some interpretable data, despite the presence of background noise and artifacts. This mixture contains incomplete adenylation at loci THO1 and stutter at loci FGA. Incomplete adenylation can result from a mishap in the PCR process, usually from the issue of having too much DNA in the sample. This

After cell lysis and DNA extraction, 100µl of DNA was stored at -30oC prior to subsequent 16S rRNA PCR and gene sequencing. Universal primers 27F; AGAGTTTGATCCTGGCTCAG and 1492R; GGTTACCTTGTTACGACTT were used to target the 16S rRNA gene. PCR amplification was performed using a thermocycler with the following program: 25 cycles for 5 mins at 94oC, 30 secs at 94oC, 30 secs at 56oC and 90 secs at 72oC. The final elongation step was performed for 10 mins at 72oC. PCR products were analysed by agarose gel electrophoresis (Figure 1) to ensure the appropriate size of the amplification product. The PCR procedures were repeated in the similar manner except adding forward and reverse primer separately. Post PCR products were cleaned using Safodex G-50per the manufacturer’s instructions. Subsequently, the filtered PCR product was collected in fresh microtiter plates and heated at 90oC for 30 mins. The PCR product was submitted to the Ramaciotti DNA Sequencing Analysis Unit, at the School of Biotechnology and Biomolecular Sciences, UNSW for DNA

A pure quality DNA should have a thick, compact single band. However the electrophoresis of the purified DNA did not exactly complement the above mentioned (Ab260/Ab280) ratio.As from figure 1 it is evident that only the band of ACHN is a single band whereas for the other two bands of MCF7 and H1650 it shows a smear which indicates that DNA is not intact.The smear DNA bands observed could be a result of degradation by nucleases.Thus to overcome this problem,one can use freshly made electrophoresis buffers or ensure that the pipette tips are nuclease –free.It is also possible that tremendously low voltage during gel electrophoresis may cause diffusion of bands orhigh voltage can cause greater heating and denaturation of

PCR (Polymerase Chain Reaction) is a laboratory technique that takes specific fragments of DNA and amplifies them using primers and a polymerase that can withstand high temperatures. The materials needed to complete this experiment include the DNA fragments that are to be amplified, two primers (one to attach to the top strand of the DNA fragment of interest and one to attach to the bottom strand on the other end), Taq DNA polymerase, dNTP mix, MgCl2, PCR buffer and the PCR machine. Primers are necessary for the Taq DNA polymerase to attach to in order to begin copying because primers can only attach to an existing piece of DNA. Taq DNA polymerase is necessary for PCR rather than DNA polymerase found in our bodies because when the DNA fragments of interest are heated in order to denature them and separate the two complementary strands, DNA polymerase also denatures. Taq DNA polymerase is taken from a strain of bacteria (Thermus aquaticus) that is taken from the hot springs of Yellowstone National Park, and it can withstand boiling temperatures which makes it effective for PCR. dNTP mix is a mixture of nucletotides that the polymerase uses to create the new

For experiment 1, we used ten sticks to represent animals, and the beads to represent alleles. The dark beads then represented a dominant allele while the light beads represented the recessive alleles. 50 dark and 50 light beads were picked out and placed in a container where we then stirred them up. The stirring of the beads helped eliminate a bias selection for the alleles. Next, we randomly chose two beads without looking, and placed a pair onto each of the ten sticks. We observed how many sticks were homozygous, or heterozygous, which helped us calculate how many big R’s (dominant allele) and how many little r’s (recessive allele) were present. Finally, we used the numbers to figure out the P value by counting the amount of dark beads present, divided by the total amount of beads in all of the population (20). Record the data onto the chart. Conduct this experiment eight times. However, after each generation test, adjust the allele pool according to the P Value. ex) if P value = 0.55, have 55 dark beads and 45 light beads in your allele pool instead of 50/50 of each.

Polymerase Chain Reaction (PCR) is a laboratory technique commonly used to make many copies of a region of DNA. PCR has many research and practical applications and It is routinely

Background: Polymerase Chain reaction (PCR) is an in vitro process that enables exponential amplification of the define target DNA sequence. The process involves three steps: denaturation, annealing and elongation. In the first step, the reaction mixture containing target

Genetics play a major role in who we are and what we become. All of our genes are inherited from our parents, and each gene will generally have two copies of that specific gene, one from each parent. We call each copy of these genes alleles. These alleles are lotus on the chromosome, with one allele from one parent, and one from the other. If both alleles are identical, they form a homologous pair, if they are different, they form a heterozygous pair. There are many different mechanisms of inheritance, involving a number of alleles. Incomplete and codominance are two different patterns of inheritance.

Once placed in the thermal cycler the micture will be increased to heat at 94o for 3 minutes and again for another minute, then cooled at 52o for 1 minute and risen to 72o for 2 minutes. The steps of heating for a minute, cooling for a minute, and room temperature for 2 minutes is repeated another 34 times. The mixture then stays at room temperature for another 10 minutes and held at 4o for until placed in a freezer. The last part of this lab is doing electrophoresis of PCR. The mixtures must be thawed out and put in the ice bucket, Two new tubes are created: a DNA tube and a water tube. Twenty microliters of the PCR micture must be added to both the DNA and water tubes. The gel dye must be added to the two tubes before continuing with electrophoresis. The final step is adding both tubes solutions to agarose gel and a picture taken of the new DNA ladder created. Materials used for PCR amplication ar ethe following: gloves, PCR tube, DNA template, PCR Master Mix, ice bucket,

The PCR product did not appear in the no-template negative control reaction. This was fortunate, as it’s easy to contaminate the reaction with foreign DNA during purification and amplification. The control functions to show that

The amount of DNA used for digesting was 3µl, determined by comparing the band pattern seen in the photo of isolated plasmid in gel (see section 3.3 A). Then a DNA stock solution was prepared by following the scheme shown in Table 2 (see appendices).

What is genetic testing? Genetic testing is a type of medical test that identifies changes in chromosomes, genes, or proteins.

Prior to performing PCR on the M. Xanthus gene, the forward and reverse primers were designed on MacVector. A PCR protocol was followed in which the following was added in the exact order; 17.5 microliters of water, 5 microliters of buffer A reaction 5x, 1 microliter of template M. Xanthus gene, 0.5 microliters of forward primer, 0.5 microliters of reverse primer, and 0.5 microliters of AccuPrime GC-Rich DNA Polymerase. The reaction mixture was run on the following program; 3 minutes at 95̊C for denaturation, 34 cycles of 30 seconds at 95̊C for denaturation, 34 cycles of annealing for 30 seconds at 60̊C, 34 cycles of extension for 2 minutes at 72̊C, one cycle of final extension for 5minutes at 72̊C, afterwards the PCR fragments were stored at 10̊C. After the M. Xanthus gene was amplified, the PCR fragments were visualized on a gel electrophoresis using gel red to ensure amplification (Figure 4). The PCR fragment was purified using the Quick-Start Protocol for the QIAquick PCR Purification Kit.

PCR reaction was carried out in a 25 μl reaction mixture under standard condition, contained 1x buffer, 0.2 mM of four dNTPS, 1.5mM mgcl2, 1 pM of forward (sequence) and reverse (sequence) primers and 50ng of genomic DNA. Initial denaturation at 95˚C for 4 min was followed by denaturing at 94˚C for 30 seconds, annealing at 60˚C for 30 seconds and extension at 72˚C for 30 seconds for 32 cycles. The final extension was 8 min. The amplicons were run on an ABI 3130x (Applied Biosystems, Foster City, California,