. a. If you found a zinc-finger domain (which facilitates DNA binding) in a newly identified gene,what kinds of hypotheses could you make aboutthe gene’s function?b. Suppose that this newly identified gene shares ahigh percentage of similarity throughout its lengthwith a previously characterized gene in the sameorganism. What does this fact suggest about the origin of the two genes? Would you categorize thesegenes as being: (i) homologous, (ii) paralogous, or(iii) orthologous? (More than one answer may apply.)

. a. If you found a zinc-finger domain (which facilitates DNA binding) in a newly identified gene,what kinds of hypotheses could you make aboutthe gene’s function?b. Suppose that this newly identified gene shares ahigh percentage of similarity throughout its lengthwith a previously characterized gene in the sameorganism. What does this fact suggest about the origin of the two genes? Would you categorize thesegenes as being: (i) homologous, (ii) paralogous, or(iii) orthologous? (More than one answer may apply.)

Name: . a. If you found a zinc-finger domain (which facilitates DNA binding)
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: . a. If you found a zinc-finger domain (which facilitates DNA binding) in a newly identified gene,what kinds of hypotheses could you make aboutthe gene’s function?b. Suppose that this newly identified gene shares ahigh percentage of similarity throug

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

Geneticists are currently considering using technologies described in this chapter to de-extinct thewoolly mammoth, a species that disappearedroughly 4000 years ago.a. Frozen specimens of woolly mammoths have beenfound in the Siberian tundra. If intact, living cellscould be obtained from these samples, how couldyou attempt to bring back these long-extinct animals using these cells and oocytes from Asian elephants, a closely related species? b. Scientists have determined the genome sequence ofthe mammoth from frozen samples. These researchers are now trying to understand the adaptations that allowed these creatures to surviveextreme cold. For example, mammoths had muchthicker hair than do any elephants. How in theorycould you use CRISPR/Cas9 to investigate thegenetic basis of the difference in hair thicknessbetween mammoths and elephants?c. How (again in theory) might it be possible to extend the CRISPR/Cas9 technique to de-extinct themammoth? What kinds of technical challenges…
. The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age of 70 withamyotrophic lateral sclerosis (ALS), a paralyzing neurodegenerative disease that is usually fatal at a muchyounger age. Recently, geneticists discovered that amajor cause of ALS is the unusual expansion of ahexanucleotide repeat (5′-GGGGCC-3′) that lieswithin a gene called C9ORF72, at a location outside ofthe gene’s open reading frame (ORF). A single expanded allele is sufficient to cause ALS, but the reasonthe disease allele is dominant remains unclear. Someexperimental results support the theory that the allelemakes a toxic RNA containing the expanded repeat. Ifthis theory is correct, in what ways is the mutant ALScausing allele similar to the mutant allele that causesHuntington disease? In what ways is it similar to themutant allele that causes fragile X syndrome?
An interesting trait that some bacteria exhibit is resistance to beingkilled by antibiotics. For example, certain strains of bacteria areresistant to tetracycline, whereas other strains are sensitive to tetracycline.Describe an experiment you would carry out to demonstratethat tetracycline resistance is an inherited trait encoded bythe DNA of the resistant strain.
Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what ways could the presence of an Alu sequence affect a nearby gene?
Null mutations are valuable genetic resources becausethey allow a researcher to determine what happens to anorganism in the complete absence of a particular protein. However, it is often not a trivial matter to determinewhether a mutation represents the null state of the gene.a. Geneticists sometimes use the following test forthe nullness of an allele in a diploid organism: If theabnormal phenotype seen in a homozygote for theallele is identical to that seen in a heterozygote(where one chromosome carries the allele in question and the homologous chromosome is known tobe completely deleted for the gene) then the alleleis null. What is the underlying rationale for thistest? What limitations might there be in interpreting such a result?b. Can you think of other methods to determinewhether an allele represents the null state of a particular gene?
The best estimate is that the human genome containsfewer than 21,000 genes. However, there is evidencethat human cells produce many more than 21,000 different polypeptides. What processes might account for thisdiscrepancy?
The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.
Researchers have successfully used gene therapy toameliorate some human genetic diseases by adding anormal gene copy to cells whose genomes originallyhad only nonfunctional mutant copies of that gene.For example, a form of blindness due to the lack of asingle protein called RPE65 has been reversed byintroduction of a normal RPE65 gene to cells of theretina of adults.a. The success of this gene therapy approach providesus with clues about the role of the RPE65 proteinin the retina. Do you think that RPE65 is neededfor the proper development of the human eye?b. Can you see a potential difficulty in applying this genetherapy approach for diseases like microcephaly?
Highly conserved genes such as those for ribosomal RNA are present as clearly recognizable relatives in all organisms on Earth; thus, they have evolved very slowly over time. Were such genes “born” perfect?
Geneticists can synthesize any gene—any stretch of DNA—desired. Suppose you use a tree of genome evolution to predictthe structure of a now nonexistent, ancient gene. What insightsmight you obtain by synthesizing the ancient gene and insertingit into a living animal?
When 1 million cells of a culture of haploid yeastcarrying a met− auxotrophic mutation were plated onpetri plates lacking methionine (Met), five coloniesgrew. You would expect cells in which the originalmet− mutation was reversed (by a base change back tothe original sequence) would grow on the media lackingmethionine, but some of these apparent reversions couldbe due to a mutation in a different gene that somehowsuppresses the original met− mutations. How wouldyou be able to determine if the mutations in your fivecolonies were due either to a precise reversion of theoriginal met− mutation or to the generation of a suppressor mutation in a gene on another chromosome?
Over a period of several years, a large hospital kepttrack of the number of births of babies displaying thetrait achondroplasia. Achondroplasia is a very rareautosomal dominant condition resulting in dwarfismwith abnormal body proportions. After 120,000births, it was noted that 27 babies had been born withachondroplasia. One physician was interested in determining how many of these dwarf babies resultedfrom new mutations and whether the apparent mutation rate in this geographical area was higher thannormal. He looked up the families of the 27 dwarfbirths and discovered that four of the dwarf babieshad a dwarf parent. What is the apparent mutationrate of the achondroplasia gene in this population? Isit unusually high or low?