. Complete genome sequences indicate that the humangenome has roughly 27,000 genes, while the worm(nematode) genome has about 22,000 genes. Explainhow the human genome with only about 20% moregenes can encode a creature enormously more complex than the worm.

. Complete genome sequences indicate that the humangenome has roughly 27,000 genes, while the worm(nematode) genome has about 22,000 genes. Explainhow the human genome with only about 20% moregenes can encode a creature enormously more complex than the worm.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 17TYU

See similar textbooks

Related questions

Q: geneticist happens upon a gene in humans that is not functional and is not currently being expressed

A: Pseudogenes are those which are present in the genome till now but do not perform any function.

Q: 2. In your own words, describe two different reasons why a eukaryotic cell may need to control gene…

A: gene expression is a process to regulate the production of active gene to produce the proteins to…

Q: 1. Since 1978, scientists used a specific biotechnology to produce a medicine used to treat…

A: Technology used: Recombinanant DNA. technology. The technology used to make DNA from…

Q: concept defines a species as a group of organisms that are capable of exchanging Mayr's genes. O…

A: Mayr's gave biological species concept. According to this concept " species are groups if…

Q: . In examining Figure 3-19, what do you think is the mainreason for the difference in size of yeast…

A: To find: The main reason for the difference in the size of yeast and human mtDNA.

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: What is the difference between orthologs and paralogs? a. Orthologs are homologous sequences;…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Discuss the characteristics of mammalian genomes thatmake them larger than prokaryotic genomes.

A: Genome refers to the genetic material of an organism, which consists of deoxyribonucleic acid (DNA).…

Q: Other than obvious changes in protein-encoding Neanderthal genes, changes in what type of non-coding…

A: Small tandem repeats (STRs) are short repeating DNA sequences (2–6 bp) that contribute for about 3%…

Q: A principle of biology is the genetic material provides ablueprint for reproduction. Explain how…

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of purines and…

Q: Two proteins from one particular yeast species are evolutionarily related. Which of the following…

A: If two proteins share a common progenitor, regardless of their sequences, structures, or activities,…

Q: Compare and contrast the experimental advantages and disadvantages of Drosophila, C. elegans,…

A: Model organisms are non-human species that are used to conduct experiments in the laboratories as…

Q: Substance that moves the electrical field solely depends on the speed of the substance in the…

A: 1. Substance that moves the electrical field solely depends on the speed of the substance in the…

Q: Explain the Gene Expression Experiment Re-Analysis Summary of Rabies Virus(Taxon:11292) Explain how…

A: Rabies is a viral disease that can be prevented by avoiding contact or bite from a rabid animal.…

Q: As part of a cancer research project, you have discovered a gene that is mutated in many metastatic…

A: Serine proteases are enzymes that degrade proteins in the extracellular matrix, specifically…

Q: Genes important in the embryonic development of animals, such as homeobox-containing genes, have…

A: Genes are the functional unit of DNA. They carry information that is translated into functional…

Q: which one would be least likely to cause Liam’s disease? Group of answer choices A. Mutation 4 B.…

A: Promoter: Is short nucleotides sequences located at 5'end that aid in switching on and off of a…

Q: You are working in a lab that studies stickleback fish. These fish normally have three spines that…

A: Introduction : The presence of three spines on the back of the sticklefish is due to the mapping of…

Q: Some evidence suggests that synonymous codons are not really synonymous. Sometimes mutations that…

A: Groups of three nucleotides represent all 20 amino acids. Each nucleotide triplet is called a codon.…

Q: 4. In the graph shown below, the dashed line shows the level of MRNA for a certain protein, Prot6,…

A: Anterior-posterior axis is defined by a line that runs from the head or mouth of an organism to the…

Q: Give an Introduction- background into the human 5 genome.

A: Genes are the units of heredity that carry genetic information. The total DNA contained in a cell…

Q: Contrast the DNA sequences dictating centromereformation in yeast and in higher eukaryotes.

A: Centromere a specialized DNA sequence of a chromosome at which sister chromatids are linked and to…

Q: What evidence supports the concept that humans share substantial sequence similarities and gene…

A: Comparison of base sequence data with other organisms indicates conservation of sequences.

Q: Over the last 10-15 years, our ideas about global transcription of the mammalian genome have…

A: Global Transcription is the transcript and whole mRNA population of cells. mRNA expression varies in…

Q: All the cells of one organism share the same genome. However, during development, some cells develop…

A: Developmental biology and stem cell biology helps us to understand more about the fate of cells. The…

Q: Woolly mammoths have been extinct for about 10,000 years, but we often find their well- preserved…

A: Cloning is a process which refers to producing multiple organisms of same type. Researchers have…

Q: 1. Let's review! The central dogma of molecular biology refers to the process of gene expression.…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: You discover that zebrafish contain a gene that has a similar sequence to Drosophila abdoless.…

A: Drosophila melanogaster also known as fruit fly studied extensively in biology due to similar…

Q: Compare and contrast the DNA of human and DNA of a chimpanzee. 2. How genetic engineering is apply…

A: Chimpanzees are genetically closest to humans, and in fact, chimpanzees share about 98.6% of our…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 7. Are there homologs for the identified gene in other systems?…

A: Hi! As you have posted multiple questions, I will be answering the first question for you. If you…

Q: Describe the human genome in terms of genome size, the percentageof the genome that codes for…

A: The 23 chromosomal pairs in cell nuclei plus a tiny DNA molecule present in each mitochondria…

Q: Gene Expression

A: Introduction The Gene Expression Omnibus (GEO) data set is a worldwide public store that documents…

Q: Why do humans have such a large number of nucleotides (3.2 billion base pairs) compared to the…

A: The genome is the sum total of all genetic material of an organism which stores biological…

Q: Comparing DNA sequences in different species indicates that more DNA segments that do not code for…

A: DNA contains lot of nucleotides and most of the DNA which do not codes for any functional product…

Q: many more mRNA transcripts than there are genes. Why isn’t the number the same?

A: Regulatory protein (or gene-regulatory protein) is any protein that controls the transcription.…

Q: Woolly mammoths have been extinct for about 4,000 years, but we often find their well-preserved…

A: Somatic cell nuclear transfer (SCNT) is a technique in which the viable embryo is developed from egg…

Q: wo genes that evolved from the same common ancestral gene, but are now found as homologs in…

A: Gene is the functional and basic unit of heredity, made up of DNA. Every organism is composed of…

Q: Name and describe three ways in which gene expressioncan be influenced after mRNA is processed and…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: You are interested in finding out the function of a particular gene in the mouse genome. You have…

A: There are multiple ways to have a distinct character for the gene expression and function. And the…

Q: Mutations are __________. A. The sole source of variation in a sexually reproducing organisms…

A: A change in the normal specific DNA sequence that can arise due to the anomaly is DNA replication or…

Q: Explain how genetic information transferred in evolved animals?

A: The genetic information transferred in evolved animals is due to the process of horizontal gene…

Q: The protein neuroD is a critical human protein translated in the brain during development. The…

Q: What is the function of the “junk DNA” in human genome? proper explanation and diagram

A: DNA (Deoxyribonucleic Acid) is the genomic material found in the cells of living organisms that help…

Q: 2. Write the base sequence of the hnRNA formed by transcription of the following DNA base sequence.…

A: hnRNA is also called as the heteronuclear RNA. Its synthesis is catalyzed by RNA polymerase II.…

Q: What evidence supports the concept that humans share substantial sequence similarities and gene…

A: Model organisms are non human species that are used in the laboratory to help scientists understand…

Q: 1. A recent technical advancement that has accelerated the study of genomes is the ability to? a.…

A: A genome, including its chromosomes, is all the DNA in an organism. Genes hold information to create…

Q: Epigenetics (epigenomics) refers to changes in the _______.

A: Epigenetics (epigenomics) refers to changes in the extent to which different DNA is expressed in…

Concept explainers

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.

Question

. Complete genome sequences indicate that the human
genome has roughly 27,000 genes, while the worm
(nematode) genome has about 22,000 genes. Explain
how the human genome with only about 20% more
genes can encode a creature enormously more complex than the worm.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Illustrate about the Map and sequence the genomes of several model organisms used in experimental genetics, including Escherichia coli, Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, and Mus musculus (mouse).
What is the difference between orthologs and paralogs? a. Orthologs are homologous sequences; paralogs are analogous sequences. b. Orthologs are more similar than paralogs. c. Orthologs are in the same species; paralogs are in different species. d. Orthologs are in different species; paralogs are in the same species.
Think Critically. Provide a concise explanation of your answer. A mutation on an autosome causes a particular protein to be overproduced, and the excess protein accumulates in the liver and damages it. Would the resulting disorder most likely be inherited in an autosomal dominant or recessive pattern? Expression of the SYR gene on the Y chromosome gives rise to the male phenotype in humans. What do you think the inheritance pattern of SYR alleles is called? 22q11.2 deletion syndrome, also called DiGeorge syndrome, causes atypical parathyroid glands, a heart defect, and an underdeveloped thymus gland. About 85% of patients have a microdeletion of part of chromosome 22. A girl, her mother, and a maternal aunt have very mild DiGeorge syndrome. They all have a reciprocal translocation of chromosomes 22 and 2. How can a microdeletion and a translocation cause the same symptoms? Why were the people with the translocation less severely affected than the people with microdeletion? What other…
Although humans and nematodes (round worms) have approximately the same number of coding genes, humans exhibit greater phenotypic complexity. This illustrates the ______________________ paradox which can be partly explained by_______________________. Group of answer choices G value, differences in gene regulatory networks (e.g., # transcription factors) C-value, cell size and transposable elements G-value, cell size and transposable elements C-value, differences in gene regulatory networks (e.g., # transcription factors)
ou now have an understanding of Genomes, DNA Replication, Transcription, Translation, and Regulation of Genes. How would you reprogram skin cells to create cells which look and behave like brain cells (neurons)? What would you change/modify to reprogram a skin cell to a neuron? How would you introduce the change/modification into the skin cells to transform them into neurons?
Genome size varies considerably among multicellular organisms. Is this variation closely related to the number of genes and the complexity of the organism? If not, what accounts for some of this variation?
Genes important in the embryonic development of animals, such as homeobox-containing genes, have been relatively well conserved during evolution; that is, they are more similar among different species than are many other genes. Explain why this is.
You are interested in finding out the function of a particular gene in the mouse genome. You have determined the nucleotide sequence of the gene, defined the portion that codes for its protein product, and searched the relevant database for similar sequences; however, neither the gene nor the encoded protein resembles anything previously described. What types of additional information about the gene and the encoded protein would you like to know in order to narrow down its function, and why?
A CRISPR locus in a bacterium contains (a) short repeated sequences (b) short DNA sequences homologous to bacteriophages (c) genes that encode guide RNAs and one or more proteins (d) a, b, and c (e) none of the preceding
Design an experiment to test the hypothesis that the differences in size among adult guppies are determined by the amount of food they eat rather than by genetic factors.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog). 10. Generate a secondary structure prediction for one identified protein.
Chimpanzees and humans are almost 99% identical in terms of DNA sequence. However, we are very different to chimpanzees in many ways including appearance. What makes us so different? Please relate in genetics lessons - Developmental Genes, Epigenetics