Q: Describe the different stages that process of Protein synthesis.
A: Protein synthesis is the cycle where cells make proteins. It happens in two phases: transcription…
Q: xplain how hydrophobic effect influence protein structure and gene expression.
A: The hydrophobic effect is the inclination of non-polar molecules and molecular portions in a…
Q: Differentiate the stepwise stages in protein folding.
A: Protein folding: a. Proteins are composed of amino acid chains that obtain their biological and…
Q: Explain how tandem mass spectroscopy is used to determinethe sequence of a peptide. Once a peptide…
A: The analytical technique that separates gaseous ions based on mass to charge ratio is mass…
Q: Illustrate the Analyze protein structure, and predict protein functionson the basis of identified…
A: Proteins are made up of amino acid chains. Protein domains are conserved polypeptide regions that…
Q: 1. If the second amino would the protein sti
A: Answer. Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They serve as…
Q: Name X and state how it functions in a protein synthesis. e) Give three differences between…
A: There are two strands which are anti parallel to each other which means they have opposite polarity,…
Q: Are peptide bonds are made only by ribosome and tRNA in vivo?
A: Peptide bonds are formed between amino acids during protein synthesis. After the tRNA properly binds…
Q: What is the name of the biennial contest for predicting protein structures from amino acid sequence?…
A: Proteins are the macromolecules composed of amino acids bound together by peptide bond between amino…
Q: How Mutations changes the resultant amino acidsequence ?
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: a) Identify three types of RNA and provide a description of each and the role they play in protein…
A: a. Mejor type or RNA is 1. Messanger RNA (mRNA) 2. Ribosomal RNA (rRNA) 3. Transfer RNA (tRNA)…
Q: Explain Modular nature of protein domains.
A: Eukaryotic proteins are standard in nature. several macromolecules contain severally folding…
Q: Suggest an explanation for the observation that when proteins are chemically modified so that…
A: A polypeptide chain is made on cellular structures, called the ribosomes. This is done by a complex…
Q: Draw at least 2 amino acids. Label the N-terminus and the C-terminus. Describe the property of the…
A: Amino acids are organic molecules composed of carbon, hydrogen, nitrogen, and oxygen. Amino acids…
Q: Explain how single nucleotide changes can have mostly different effects on protein function.
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: e impact of mutations on the function of the protein
A: Mutation can lead to change in the triple base pair sequence which can lead to change in the amino…
Q: 2. A protein has the amino acid sequence DSRLSKTMYSIEAPAKLDWEQNMAL How many peptide fragments would…
A: The proteases are responsible for the breakdown of protein into smaller fragments. Examples of…
Q: or each denaturing agent, explain the changes that can be observed in terms of change in protein…
A: Denaturation is the loss of the native proteins' three-dimensional structure. Denaturation is the…
Q: Explain the basis for the great diversityof proteins.
A: Proteins are polymers of amino acids and they are large in size. Proteins carry out several critical…
Q: Most genes encode proteins. Explain how proteins produce anorganism’s traits. Provide examples.
A: Protein expression Every gene coded for a specific protein. The central dogma of life includes the…
Q: Define the following terms:a. protein motifb. conjugated proteinc. dyneind. zwitterione.…
A: Introduction: Proteins are major biomolecules that consist of long chains of amino acids. The…
Q: Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If…
A: The genetic codon present in the mRNA will be translated into polypeptide chain by ribosome during…
Q: Discuss how mutations impact protein function. Namely hypothesis the affect these particular…
A: Mutations, variations in a gene's DNA sequence, occur in nature spontaneously. Since alleles are…
Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…
A: Proteins are important for the normal functioning of the human body. Proteins are made of amino…
Q: Explain how mutations can af
A: Proteins are macromolecules or large biomolecules, which comprise one or multiple chains of amino…
Q: A point mutation occurs in the middle of the coding sequence for agene. Which types of…
A: Mutation is the process of abrupt changes in the nucleotide sequence or gene in the DNA. Mutation…
Q: Illustrate why amino acids can exists as streoisomers.
A: Streoisomers are molecules with same structural formula but different arrangement of atoms in space.…
Q: nucleotide sequence has providen to you, you have only the name of source organism. - how will you…
A: For finding the nucleotide sequence for proteins first Use the NCBI BLAST service to perform a…
Q: what is the sequence of peptide 1?
A: A nonpeptide is the a polypeptide containing nine amino acids linked via peptide bonds. The sequence…
Q: B-barrel proteins often create pores in cellular membranes. What kind of amino acids are likely to…
A: In protein structures, a beta barrel is a beta-sheet composed of tandem repeats that twists and…
Q: Explain how point and frameshift mutations affect the protein structure and function.
A: Shift in a DNA sequence is a mutation. Mutations can result from copying errors produced by DNA…
Q: List 2 proteins that facilitate protein folding and briefly describe the role each play in the…
A:
Q: Why can one not reliably predict the sequence of nucleotides onmRNA or DNA by observing the amino…
A: The amino acids on a protein are coded for by codons on the mRNA, which in turn was transcribed from…
Q: Describe how to predict intrinsically disordered proteins (IDP) and intrinsically disordered regions…
A: Intrinsically disordered regions are polypeptide segments that do not form a defined…
Q: Describe the effect of the substitution mutation in a sequence of amino acids.
A: Mutation can be outlined as the change within a DNA sequence and it basically results from the…
Q: Vhere in your cell can you find the instructions for how to make all of the proteins?
A: The central dogma of molecular biology is the process by which DNA gets converted into RNA, and RNA…
Q: Describe SDS-PAGE as a means of separating proteins.
A: Introduction SDS-PAGE is a two-dimensional gel electrophoretic technique used in the separation of…
Q: Explain how a protein ensures that it binds specifically to only a certain region of DNA and not…
A: DNA binding proteins have structural compatibility by the presence of DNA binding domains which make…
Q: DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?
A: CAT CTA CAA ATA GCA CCT AAT TGT G (DNA)
Q: Predict the amino acid sequence produced during translationof the short theoretical mRNA sequences…
A: Sequence 1: 5'@AUG CCG GAU UAU AGU UGA @3' met pro asp tyr…
Q: Which group is nonpolar and affects gene expression? Which functional group(s) shown above is (are)…
A: Methyl group (-CH3) is nonpolar and it affects the DNA structure by methylation which causes an…
Q: Explain the significance φ, ψ contour diagram in proteins and explore how is it interpreted?
A: The contour plot of phi and psi dihedral angles is also called the Ramachandran plot. Ramachandran…
Q: The goal of structural proteomics project isa) To crystallize and determine the structure of as many…
A: Proteomics, a term derived from "protein" and "genomics," needs further definition, as do proteomics…
Q: Discuss the role of molecular chaperones in protein folding, and list some important examples of…
A: In molecular biology, the proteins are responsible for assisting in the conformational folding or…
Q: Describe the machanism of protein folding, highlighting the roles of chaperons.
A: Chaperons help to fold new proteins into their proper form. If we observe many structures in the…
Q: =Suggest, which part of these sequence referred to inner core of the otein/ outer core (use single…
A: Hydrophobic: A, C, I, L, M, F, W, V. Neutral: G, H, P, S, T, Y. Hydrophilic: R, N, D, Q, E, K
Q: How is it that protein–protein interactions thatare too weak to cause proteins to assemble in…
A: Protein is usually defined that they are about to define as a highly complex substance found in all…
Q: Referring back to the quaternary level proteins, list and describe the modifications that can be…
A: The structure of protein includes sequence of amino acids in a polypeptide chain. The formation of…
. Describe how missense mutations were used to show
that genes determine the amino acid sequences of
proteins
Step by step
Solved in 2 steps
- Explain how silent mutations affect the structure and function of the protein.Looking at a silent mutation, explain in your own words how this type of mutation will affect the structure and function of a protein.Briefly describe the process of protein making.include the functions of mRNA ,tRNA, and rRNA
- Discuss how mutations impact protein function. Namely hypothesis the affect these particular mutations might have on protein function.Explain how hydrophobic effect influence protein structure and gene expression.explain in your own words how silent mutation will affect the structure and function of a protein.
- DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?Explain how polypeptides are arranged to form the primary, secondary and tertiary structure of a protein how mutations can cause a change in the sequence of amino acids of a polypeptide? Compare the effects of addition/ deletion mutations and substitution mutationsa nucleotide sequence has providen to you, you have only the name of source organism. - how will you find the sequence? describe the steps. - you are informed that this sequence codes for protein how would you identify the protein using only the sequence? describes your methos using an example.
- a) what does this suggest. b) suggest a macromolecule where this modification might occurIllustrate the Analyze protein structure, and predict protein functionson the basis of identified domains and motifs ?Determine the identity of the N-terminal amino acid after reconstructing the intact protein. Why is this answer correct and why are the others incorrect? A. Asp B. Ser C. Glu D. Ile