1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?

1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 6QP: Although it is well known that X-rays cause mutations, they are routinely used to diagnose medical...

See similar textbooks

Related questions

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence so that the…

Q: What is the purpose of DNA methylation? Why is it ineffective in the DNA repair of spontaneous…

A: DNA methylation is the process of adding methyl groups to DNA at Nucleotide bases, so that without…

Q: Trichothiodystrophy is a human inherited disorder characterized by premature aging, including…

A: Trichothiodystrophy is a rare, autosomal recessive disease which is characterized by brittle sulfur…

Q: The following is a list of mutational changes. For each of the specific mutations described,…

A: A mutation is defined as a change in the DNA sequence due to either mistake during DNA replication,…

Q: What causes mutation? Is it always harmful? • Does a simple change on DNA sequence affect the…

A: DNA or deoxyribonucleic acid is the genetic material in living organisms. It is composed of…

Q: "The molecule serving as the genetic material is expected to absorb at the wavelengths shown to be…

A: DNA is a double-stranded molecule with helical structure. It has made of nucleotides containing four…

Q: Define the silent mutation in DNA? (2.5 marks) 2) What is the codon usage bias? (2.5 marks) 3)…

A: Answer 1) Silent mutations are DNA mutations that do not result in a change to the amino acid…

Q: The following is a list of mutational changes. For eachof the specific mutations described, indicate…

A: Hello there! As you have posted multiple questions, we are answering only the first three questions…

Q: Why might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal…

A: Mutation It is the sudden heritable changes happening in the genotype of the organism which is…

Q: What is the difference between a germline mutation and a somatic mutation?

A: A mutation is a biological process occurring in the Deoxyribonucleic acid (DNA) sequence due to…

Q: Eukaryotes have repair systems that prevent mutations due to copying errors and exposure to…

A: Eukaryotic cells are complex and multicellular in nature. It consists of a true nucleus, that is the…

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A mutation is a change that occurs in our DNA sequence, which might occur due to mistakes when the…

Q: What is a A hypomorphic mutation?

A: The change in normal structure or function of a wild type of gene due to alteration in nucleotides,…

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence, so that the…

Q: What is a driver mutation?

A: Mutations are defined as the change in the sequence of DNA of an organism due to any environmental…

Q: What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was…

Q: What would happen to DNA repair in bacteria if MutH is mutated such that is cannot recognize the…

A: In prokaryotes , Mut H involved in mismatch repair syatem. Mut S can recognise mismatched…

Q: The letters ABCDEFGH represent a normal DNA sequence. Indicate the type of mutation present in each…

A: Whenever there is a normal DNA sequence, but after DNA replication, or due to cellular stress or due…

Q: It has been noted that most transposons in humans and other organisms are located in noncoding…

A: Transposons: Transposons are also referred to as "jumping genes" in which they have the ability to…

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: Silent mutations are mutations in DNA that do not have an observable effect on the organism's…

Q: Identify the type of mutation and how it would affect the protein made (amino acid) if the following…

A: Mutation It is defined as the alternation in the sequence of the DNA. This change occurs when the…

Q: Provide one example of a clinical implication of a “silent mutation” that has proven to have an…

A: Natural selection is an evolutionary mechanism and organisms that are more environmentally suited…

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

Q: What type of mutation is shown in the diagram? Why do you think this type of mutation is referred…

A: Mutations are alterations in the gene sequence due to presence or interference of certain mutagenic…

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence, so that the…

Q: 1) Define the silent mutation in DNA? 2) What is the codon usage bias?

A: Hi! As you have posted multiple questions and have not mentioned which one is to be answered, we are…

Q: Which of the following statements about a transversion mutation in the sequence AGC is true?

A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…

Q: Two types of mutations discussed in this chapter are 1) nucleotide changes and 2) unstable genome…

A: Mutations are sudden heritable changes in the DNA sequence of a gene and are responsible for all the…

Q: As we described in class, in the early 1960's Francis Crick and colleagues set out to determine how…

A: Introduction Genetic code The sequence of bases that encodes a functional protein molecule is…

Q: 1) Define the silent mutation in DNA? 2) What is the codon usage bias?

A: Hi! Thanks for the questions. As you have posted multiple questions, I will be answering the first…

Q: TACAT

A: Solution :There are three types of DNA Mutations: base substitutions, deletions and insertions.

Q: Cytosine

A: Introduction :- A mutation occurs when a DNA gene is damaged or changed in such a way as to alter…

Q: Explain why STR mutations are found at a much higher frequency than single nucleotide changes?

A: STR means single tandem repeat, and the mutation in the STR segments is at a very high rate .

Q: What is the minimal number of insertions/deletions of nucleotides that would result in a frameshift…

A: A mutation happens when a DNA (deoxyribonucleic acid) gene is broken or modified causing the change…

Q: How many codons are there in the mutated DNA-(b) and DNA-(c)? What types of mutations occurred in…

A: Codon is sequences of three DNA or RNA nucleotides.

Q: Where does RNA processing fit into the central dogma of molecular genetics?

A: The central dogma is the process which governs the gene expression. A gene is expressed when an mRNA…

Q: What is a silent mutation? Why is the name “silent mutation” a bit of a misnomer?

A: The flow of information in the cell is generally from DNA to RNA to proteins. DNA contains the…

Q: What are the three possible effects on the cell (or organism) when a mutation occurs in DNA? Which…

A: A mutation happens when a DNA gene is disrupted or altered in such a manner that the hereditary…

Q: Which DNA strand is identical to the mRNA transcript? Which DNA strand codes the RNA transcript?

A: DNA contains the instructions for protein synthesis. Proteins in turn determine structure and…

Q: A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously…

A: Answer of the question given below...

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence, so that the…

Q: What Is the Molecular Basis of Mutation?

A: Introduction Mutations in the genes may be caused artificially or occur naturally. When an organism…

Q: Define and compare the outcomes of the following types of nucleotide substitutions, insertion or…

A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…

Q: Why are frameshift mutations likely to be more detrimental than point mutations, in which a single…

A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A silent mutation is a change in the sequence of nucleotide bases that constitutes DNA, without a…

Q: As we focused on the genetic code and the transcription of genetic information stored in DNA into…

A: Introduction: Splicing is a process where non-coding sequences of an m-RNA is removed from the…

Question

Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) :

1) Define the silent mutation in DNA?

2) What is the codon usage bias?

3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?

Definition Definition Observable physical traits or characteristics of an organism, which are determined by its genetic makeup (genotype) as well as environmental factors. These traits can include anything from eye color or height to behavior or disease susceptibility. Understanding an organism's phenotype is important in fields such as genetics, medicine, and ecology.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions?1) Define the silent mutation in DNA? (2.5 marks)2) What is the codon usage bias? (2.5 marks)3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics? (10.0 marks)
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages provideanswers for the following questions?1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics?
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)
What three different types of mutations involve changes in a single base, and what effect can each of them have on a coding sequence? Which type is the most common? Which type has the most severe effect on the function of the encoded protein?
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions? Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics?
Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′
If the mutation causing Tay Sachs disease involves a C to T change at position 4 in the sequence AAGCGTTAGCTAGGCC, what probe would you use to detect the mutation in individuals concerned about carrying the disease?
The letters ABCDEFGH represent a normal DNA sequence. Indicate the type of mutation present in each of the following situations: a) ABCCDEFGH b) ABCDEGH
A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously substituted for glutamic acid during protein synthesis. What kind of mutation might be underlying this defect? How could you test this hypothesis?
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
What is the result of Frameshift mutations from the insertion or deletion of nucleotides within the coding sequence?
What type of mutation is shown in the diagram? Why do you think this type of mutation is referred to by this term?