1. What is the correct order of enzyme action during DNA replication? Number the steps from 1 to 7. HINT: Refer to the slide show and video lecture on this topic to help you solve this one: Synthesis of RNA primers (priming) Ligation Helicase/topoisomerase activity Single-stranded binding proteins bind and prevent reannealing DNA polymerization/proofreading 5'-3' exonuclease activity/DNA polymerization Binding to origin of replication (AT rich sequence)

1. What is the correct order of enzyme action during DNA replication? Number the steps from 1 to 7. HINT: Refer to the slide show and video lecture on this topic to help you solve this one: Synthesis of RNA primers (priming) Ligation Helicase/topoisomerase activity Single-stranded binding proteins bind and prevent reannealing DNA polymerization/proofreading 5'-3' exonuclease activity/DNA polymerization Binding to origin of replication (AT rich sequence)

Name: I. What is the correct order of enzyme action during DNA replication?
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: I. What is the correct order of enzyme action during DNA replication? Number the steps from 1 to 7.HINT: Refer to the slide show and video lecture on this topic to help you solve this one:Synthesis of RNA primers (priming)LigationII. A double-strand

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Similar questions

Which of the following phases is characterized by preparation for DNA synthesis? G0 G1 G2 S
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.
Explain the effect(s) the following scenarios would have on DNA replication or translation. For each scenario, state whether DNA replication or translation would be able to proceed and explain your reasoning. Low amount of 7- methyl guanosine in the nucleus low amount of DNA polymerase I lack of helicase
The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
Please help me to answer the following: 1. Explain how the synthesis of a DNA daughter strand growing toward a replication fork differs from the synthesis of a daughter strand growing away from a replication fork. 2. The base sequence ACGTCT represents a portion of a single strand of DNA. Please draw the complete double stranded molecule for this portion of the strand and use the representation to illustrate the replication of the DNA strand.Please clearly identify the nucleotide bases involved, the new strands formed, and the daughter DNA molecules. 3. Please explain the origin of Okazaki fragments. Thank you very muxh for your help.
a) Explain how the molecular mechanism of DNA polymerase enhances DNA replication. b) Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading
Below is a diagram of DNA replication as currently believed to occur in E. coli. From specific points, arrows are provided that lead to numbers. Answer the questions below relating to the locations specified by the numbers. (02) What end (5’ or 3’) of the molecule is here? (State which) What enzyme is probably functioning here to deal with supercoils in the DNA? What enzyme is probably functioning here to unwind the DNA? What nucleic acid is probably depicted here? What are these short DNA fragments usually called? What enzyme probably functions here to couple these two newly synthesized fragments of DNA? Is this strand the leading or lagging strand? What end (5’ or 3’) of the molecule is here? (State which)
ii) Assume that the following polynucleotide is part of a longer DNA molecule. Write out the product that would be obtained from its replication.3 AAGCTTTCCG
Which statements are true? Explain why or why not.1 The different cells in your body rarely havegenomes with the identical nucleotide sequence.2 In E. coli, where the replication fork travels at 500nucleotide pairs per second, the DNA ahead of the fork—in the absence of topoisomerase—would have to rotate atnearly 3000 revolutions per minute.3 In a replication bubble, the same parental DNAstrand serves as the template strand for leading-strandsynthesis in one replication fork and as the template forlagging-strand synthesis in the other fork.4 When bidirectional replication forks from adja-cent origins meet, a leading strand always runs into a lag-ging strand.5 DNA repair mechanisms all depend on the exis-tence of two copies of the genetic information, one in eachof the two homologous chromosomes
Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?