17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTTGTCAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-300 1 --+------ 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCT 80 TTCATCTTCCAGTAC-5'
Q: d. Mark the two DNA damage checkpoints e. Mark the chromosome alignment (spindle) checkpoint
A: Cell cycle defines the sequence of events that occur during cell division. There are different…
Q: Concept map cavities and sinuses of the skull that does not contribute to the nasal cavity or…
A: This question pertains to the human skull's complex network of cavities and sinuses. These spaces,…
Q: The following figure shows the 3D structure of a tubulin dimer. A mutation in the beta tubulin…
A: Tubulin is a dimer consisting of two closely related polypeptides, α-tubulin and β-tubulin. Alpha-…
Q: what are the structural features of the coronary arteries and how does they link to its function?
A: The coronary arteries are a network of blood vessels that supply oxygenated blood to the heart…
Q: You've been out in the field collecting data on the predation of holly leaves. You collect 200…
A: Predation is the phenomenon of the feeding habit of certain organisms in which one organism hunts…
Q: True or False? With older age, rates of depression and "any mental illness" are usually lower than…
A: Mental illness refers to a wide range of conditions that affect a person's thinking, emotions,…
Q: The following is a matching question, below is text interepreted. Match each term to the best…
A: Ecology is the scientific study of organisms' interactions with their surroundings. It investigates…
Q: Which substances are activly (primarly or secondary) vs passively transported from the filtrate.…
A: In renal physiology, the movement of substances from the filtrate in the nephron involves both…
Q: Which route does a pocket of air follow through the avian respiratory system during the first…
A: Among vertebrates, the avian respiratory system is distinct because it has two components: the lungs…
Q: 3. Read the following passage: When oestrogen concentration is high it stimulates the release of LH.…
A: The pituitary gland produces and secretes luteinizing hormone (LH). LH is important in the menstrual…
Q: Do your results conform to the proposed inheritance mechanism for these traits? Are there…
A: The question involves interpreting a table of data from a class experiment, which recorded various…
Q: Question: is the Alberta grizzly bear a endangered species
A: Grizzly bear (Ursus arctos horribilis) is one of the popular species of bear found in Alberta. Their…
Q: An iv volume of 1500 ml os ordered to infuse at 76ml/hr. How long will it take for volume to infuse?
A: IV volume refers to the amount of fluid or medication administered intravenously (IV) to a patient.…
Q: Which of the following is a function of a radiology information system? Creates 3-D images of an…
A: In the realm of healthcare, radiology plays a vital role in diagnosing and treating various medical…
Q: A human chromosome (During Mitosis) is 4 µm long but contains 16 mm of DNA. What is the packing…
A: There are a few important points. DNA will exist in a nucleoprotein complex known as chromatin. A…
Q: Give typing answer with explanation and conclusion The following bacteria are listed with a…
A: Necrotizing fasciitis is a severe soft tissue infection caused by certain types of bacteria…
Q: 4. Look at the graph on the following website: https://climate.nasa.gov/vital-signs/global-…
A: The provided graph from the website displays crucial information regarding global surface…
Q: Calculate your individual fluid needs in cups per day. How did you arrive at your answer? Why is…
A: Maintaining our health and well-being requires that we understand our fluid requirements and the…
Q: Which of the following is NOT a way that humans benefit from plants today? Plants are a source of…
A: Plants are vital to human society's existence and success on many different levels. They play a…
Q: Which below shows the best explanation for why "paranoia" might have a "functional" benefit for some…
A: Paranoia is a term used in psychology and psychiatry to describe a state of excessive or irrational…
Q: Give only typing answer with explanation and conclusion A circular double-stranded DNA molecule…
A: This question pertains to the structural complexity of DNA, specifically its supercoiling…
Q: The table below shows four human populations (CLM, MXL, PEL, PUR). A single nucleotide polymorphism…
A: According to Hardy Weinberg equilibrium, both allelic and genotypic frequency will remain the same…
Q: Thymine Cytosine Adenine Guanine Nucleobases of DNA Base pair DOODL Helix of sugarphosphates DNA…
A: DNA is the main hereditary or genetic molecule that is the unit of inheritance. It is required to…
Q: Choose true or false for each of the following statements: A. Neanderthal DNA shows that they share…
A: Note:- Sorry, since you have posted multiple questions, we will be solving the first three for you,…
Q: 3. This is the same gene as #1, but with a mutation!! (G/C-C/G at base pair 28) a. Where in the gene…
A: Mutations occur when there is a sudden inheritable change that takes place in the genetic material.…
Q: A. The principle that human biology and culture evolved together and are intertwined makes…
A: Our examination into the evolution of mankind takes us on a journey over the disciplines of human…
Q: Which part of the airway does smooth muscle play its greatest role in Poiseuille's Law? O A. Trachea…
A: Poiseuille's Law is a mathematical equation that describes the relationship between the pressure,…
Q: Figure 4 below shows a midsagittal section through a human brain. Identify the structure most…
A: The SCN is a tiny region located within the hypothalamus, just above the optic chiasm. It is…
Q: Match the following structures with the group in which they can be found. Structure A cell wall made…
A: Different organisms poses specific characteristics by which they can be classified. Those…
Q: what happens if a cell is a receptor for a particular signaling molcule?
A: "Cell" typically refers to a basic unit of life found in all living organisms. It is the smallest…
Q: Plasmodesmata in plant cells are most similar in function to which of the following structures in…
A: Plasmodesmata is a channel that connects two adjacent cells and helps in the transport of molecules…
Q: Aside from biomedical applications, in what field can biomaterials be useful? Briefly discuss.
A: Biomaterials, materials designed to interact with biological systems, offer versatility beyond…
Q: Through a series of experiments, we will now investigate how the human eye detects light in two…
A: Cone visual pigments, which function as photoreceptor molecules and are found in vertebrate cone…
Q: explain the composition, process, and parts of an air gap membrane distillation
A: There are a few important points about membrane distillation. With the help of membrane…
Q: Which of the following terms is associated with the probability of a preparation not being sterile…
A: In order to sterilize an item, surface, or medium, all microbiological life—including bacteria—must…
Q: c. An American curl is a breed of cat that has curly ears. The allele for the curly ears is dominant…
A: The genotype refers to the genetic constitution of an organism. The phenotype refers to the…
Q: Match; Non-toxic dinoflagellate and Non-toxic dinoflagellate and diatoms: A. Low oxygen areas or…
A: diatoms are essential microalgae that play significant roles in primary production, biogeochemical…
Q: 5a. In Activity 1, you may have noticed that we mutagenized a haploid strain. Haploid strains are…
A: Haploid alludes to the presence of a single set of chromosomes in an organic entity's cells.…
Q: In the module, you have learned about P-element mediated transgenesis in Drosophila and the concept…
A: Since the discovery of Drosophila genetics by Thomas Hunt Morgan and his associates more than a…
Q: 6. Fill in the table below with your totaled results: Strains Group 1 Group 2 Group 3 Group 4 Group…
A: In the context of studying different strains of an organism, researchers have examined their…
Q: Genus Species Leaf leaf arrangement Family: Pinaceae
A: The patterns of leaf arrangement on a plant's stem are known as phyllotaxy. Every type of plant has…
Q: You can use some answers more than once & some not at all. Ectothermic, lungs, rubbery eggs with…
A: Reptiles are ectothermic (cold-blooded), have lungs for respiration, lay rubbery eggs with amniotic…
Q: What is an advantage of a degenerate genetic code? O Mutations are less likely to alter protein…
A: Ans.5 Multiple codons that code for the same amino acid exist due to the genetic code's…
Q: Describe: Population aging and increased longevity are creating more multi- and intergenerational…
A: Population aging and increased longevity in the U.S. have led to the emergence of more multi- and…
Q: 30. Refer to the figure shown here. Which of the following would have been a selective agent or…
A: Evolution is a process that involves the change in the characteristics of a species over multiple…
Q: Sponge Cnidarian Annelid Mollusk 4 things they don’t have in common in each section 4 things they do…
A: All animals are included in the Kingdom Animalia. The animal kingdom is the largest one of the five…
Q: Name two main factors which controls grain sorghum planting density 2.Explain in your own words how…
A: Agriculture is a primary activity by which we can cultivate soil and produce crops for food.
Q: 1) Analyse the following experimental set-up (illustrated in Figure 1) a) A wild-type (WT) bacterial…
A: Non-selective media is a basic culture medium that does not contain any selective agents, thereby…
Q: Choose the 2 groups of organisms that would most well preserved in the fossil record? Slime mold…
A: The conservation of living beings within the fossil record is impacted by different components, such…
Q: 5. Diagram a detailed receptor tyrosine kinase signaling pathway.
A: RTK signaling pathways are critical cellular communication systems that are crucial in controlling a…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 4 images
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and write the mature mRNA sequence. Then write the amino acid sequence of the resulting transcript. AGAGCTACCAGCTTTAGCGGGATATAAACACACTTATCCTACTATCCCTA 51 TCTTCCCCCAAAGAGGGATCATGCCGTCGACGGCCAAACCGATCGAGCGG 101 AGGTTAAGGGCCATTGGAAAAGGACACTCTGTACGACTAAGAAAATAGC 151 AGCGACTGAGCTGAACGCTACGGGGGGGGGGGTATATACCCCCCCCCCCC 201 CCAGCTACGAGCGACTTTTTATTTTTTTTTTTTATTTTTTTTCTTTTTTA 251 TTTTTTTTGTTTTTTTTTTTCGCGACTACAGAGACTTCTAGCGATCGACG 301 AGCTAGCTAGCGCGGCATCGGACGCGATCGCGATCCTAGACTCTACGATGiven the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
- 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAAssume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
- Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’- ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNAHere is the sequence of a portion of a bacterial gene. The template strand is on the bottom:5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’(a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect?
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ How many amino acids are in the peptide encoded by the gene? _____________Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG CAA GTG a.AUG CCG UAG CUU GAG b.AUC GGC UAC GUU CAC c.ATC GGC TAC GTT CAC d.UAG CCG AUG CAA GUG