2. For the DNA molecule shown below, the 5' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) DNA 5'GCTTGATCAGCTAGTCCATC GATCGGTCCTCGGAGCCCATTAAGGTAGC 3' DNA 5' 3'CGAACTAGTCGATCAGGTAGCTAGCCAGGAGCCTCGGGTAATTCCATCG mRNA 5' Protein ALA A Alanine Arginine R ARG Aspartic Acid ASP D Asparagine ASN N Cysteine Glycine Glutamic Acid Glutamine Histidine Isoleucine Leucine Lysine CYS с G GLY GLU E GLN Q HIS H ISE I LEU L LYS K Methionine MET M Phenylalanine PHE F PRO P Proline Serine SER S Threonine THR T Tyrosine TYR Y Tryptophan TRP W Valine VAL V First letter U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC CAA CAG AAU AAC Histidine Glutamine GAA GAG Asparagine AAA AAG Lysine GAU Aspartic GAC acid Glutamic acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC GGU GGC Arginine AGA AGG Arginine GGA GGG Serine 3' Glycine UCA CAG SCAO Third letter

Q: True or false Explain your answer You can observe the thylakoids in a Cyanobacteria with the use…

A: A class of photosynthetic bacteria known as cyanobacteria have internal membrane structures known as…

Q: Which ion or ions are transported? This transporter requires ATP? (Y or N) This protein is…

A: Transportation of specific molecules or ions depends on their chemical properties and concentration…

Q: What role do microbial symbionts play in shaping the ecological interactions between plants and…

A: Microbial symbionts are microscopic organisms, such as bacteria, fungi, and viruses, that maintain a…

Q: there is no bioavailable glucose and carbohydrates, so keep in mind those conditions and answer that…

A: Cellular respiration is a metabolic process by which biological cells converts the organic…

Q: Why is water tested for coliform bacteria rather than for pathogenic bacteria which may be present?

A: Water quality testing plays a crucial role in safeguarding public health and ensuring the safety of…

Q: Define TWO out of the followings. K2 Monosaccharide Plastic Polvmers Cellulose Sanonification

A: A monosaccharide is the simplest form of a carbohydrate, often referred to as a single sugar…

Q: Mitochondria are separated into two compartments, the matrix and the intermembrane space, by their…

A: Mitochondria are membrane-bound organelles found in eukaryotic cells. They are often referred to as…

Q: Bascillus bacteria is of which shape? a- rod shape b- spring like c- circle shape d- oval shape

A: Small, single-celled organisms called bacteria exist. Nearly all areas of the world are home to…

Q: How does dilution affect the concentration of enzymes and their catalytic activity in a biological…

A: Dilution refers to the process of reducing the concentration of a solute in a solution by adding…

Q: Consider this claim: Changes in environmental conditions always result in new ecosystems and loss of…

A: The relationship between environmental conditions and ecosystems, as well as their impact on…

Q: Briefly explain the rationale for deciding on sample size for a population study. Identify Three…

A: Due to practical constraints including time, money, and resources, it is frequently difficult for…

Q: Are there specific E. coli strains used to make competent cells? Explain the characteristics of…

A: Competent cells are the bacterial cells which take up foreign DNA by the process of transformation.…

Q: Which of the following statements is TRUE? Log cell numbers Time a) The generation time for bacteria…

A: The image depicts bacterial growth curve. It consists of four phases of growth. they are lag phase,…

Q: QUESTION 5  5.1 Outline the disorders associated with the reduction of platelets, and the possible…

A: Thrombocytopenia refers to a condition characterized by a reduced number of platelets in the blood.…

Q: What Philippine foods are similar to tempeh?

A: Tempeh, also known as tempe, has grown in popularity over the past 10 to 15 years, particularly…

Q: Give only typing answer with explanation and conclusion Information: 1_Green Fluorescent Protein…

A: In molecular biology and genetic engineering, the expression of target proteins in host organisms is…

Q: How does ninhydrin chemically react with histidine in a ninhydrin test? How does pH affect this…

A: Ninhydrin test is a chemical test to analyse, if a given analyte has amines or α amino acids. The…

Q: Retinal is therefore a key player that triggers a series of activation in phototransduction (see…

A: Several chemical mechanisms are involved in the phototransduction process in photoreceptor cells,…

Q: How does alternative splicing and proteolytic cleavage affect protein pro/hormones of the same gene?

A: Alternative splicing and proteolytic cleavage are post-transcriptional and post-translational…

Q: What are some unique complications that can arise during specific life stages in organisms, and how…

A: Every organism goes through different life stages, starting from birth, growing into adulthood,…

Q: Controls the outputs of the cortex and regulates motor activity. Central pattern generators.…

A: The segmental level refers to the neural processing that occurs at the level of the spinal cord. It…

Q: What is the bacteriological standard for drinking water in the Philippines?

A: Water is a basic human requirement. Essentially, it is used for drinking, food cooking and…

Q: Swim bladders in fish and lungs in terrestrial animals have a common evolutionary origin, but have…

A: Swim bladders in fish and lungs in terrestrial animals have a common evolutionary origin,…

Q: How can healthcare professionals find a balance between protecting public health and maintaining…

A: Healthcare professionals should be familiar with and adhere to legal and ethical guidelines such as…

Q: In humans, the recessive allele that causes a form of red-green colour blindness (c) is found on the…

A: In this case, the mother is homozygous with normal colour vision (XN XN) and the father is…

Q: TRUE OR FALSE 1. An example of a codominant feature in certain plants is the formation of pink…

A: The genotype refers to the genetic makeup of an organism. It represents the specific combination of…

Q: Enhancers promoters changing transcription potential insulator sequence translation distant the same…

A: 1. Enhancers can regulate genes from a distance, and yet they influence expression of only some…

Q: A moist soil has a volume of 13055.4 cm3, and weight of 229 N. The sample was placed in the oven at…

A: The given question involves the analysis of a soil sample in order to determine various properties…

Q: please give a step by step simple and easy to understand explaination referencing the skeletal…

A: Interleukin 6 (IL-6) is a type of cytokine, which is a small protein molecule that plays a crucial…

Q: Explain how muscle velocity changes with varying muscle force (tension) during the different types…

A: The process in which the fascicles i.e. the muscle fibers become short and enlarges to produce…

Q: owing in styles after controlled hand-pollinations in which the two species served as pollen donor…

A: Microsporangia is the male reproductive organ in the plant where the formation of pollen tube takes…

Q: he impulse  travels

A: The impulse in the heart travels in a specific order to coordinate the contraction and relaxation of…

Q: How would you prepare a 10-7dilution from a culture? Each of your dilution tubes cannot hold more…

A: Dilution is the process of lowering a solute's concentration in a solution, typically by mixing it…

Q: 1. Match the early embryo characteristics with the correct stage of development. Not all choices…

A: Embryology is a branch of science which deals with the study of embryo development. Embryology helps…

Q: What role can advancements in forensic biology play in the investigation and resolution of criminal…

A: Forensic biology is a sub-discipline of forensic science that focuses on the application of…

Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…

A: The phylogenetic tree and the molecular cladogram are both important tools in molecular biology and…

Q: 3. Chemical X inserts channels into bacterial cell membranes. Rhodospirillium, a purple non-sulfur…

A: Photosynthesis is a pathway by which all plants and some bacteria produce energy by utilizing carbon…

Q: “Model System For Yeast” can you give a clear concise overview of what this topic is and elaborate…

A: Due to its distinct traits and numerous uses, yeast has attracted a lot of attention in biological…

Q: What are the potential long-term effects on disease transmission dynamics when a new host species is…

A: The transmission dynamics of diseases within an ecosystem are deeply influenced by the diversity of…

Q: True or false Explain your answer To observe the Bacterial species E. coli with bright field…

A: Bright field microscopy is a widely used technique in which specimens are observed under normal or…

Q: Calcium storing membranous network in muscle fibers Transmit the action potential to the interior of…

A: The motor neuron's axon receives an action potential.On the axon, the action potential opens…

Q: Describe how the antigenic components of current viral vaccines are produced and describe the…

A: A coronavirus is a type of virus belonging to the family Coronaviridae. Coronaviruses are named for…

Q: Which of these sampled habitats would have the higher Shannon-Wiener diversity index value? A OA B B…

A: Biodiversity contributes to the overall functioning and resilience of ecosystems. Each species has a…

Q: How many ATP (net) are made in the glycolysis part of cellular respiration? How many ATP are made in…

A: The complete oxidation of glucose to yield ATP is referred to as cellular-respiration. There are…

Q: How does the presence of a keystone species affect the stability and diversity of an ecosystem's…

A: The presence of a keystone species can have a significant impact on the stability and diversity of…

Q: Explain ; Chemoreceptors Stretch receptors Thermoreceptors

A: Sensory receptors are trained to recognise specific types of stimuli. They transform the stimulus…

Q: Yeasts are a type of fungi. As heterotrophs, yeasts obtain energy by consuming organic substances,…

A: Yeasts are a type of eukaryotic microorganisms belonging to the fungal kingdom. They are unicellular…

Q: An incomplete pedigree for a family with a genetic condition is shown. This condition is autosomal…

A: The manner of inheritance regarding a particular feature or condition is described by the genetic…

Q: 5. Consider mitotic division. In which phase do kinetochore-microtubules depolymerize? A. Metaphase…

A: Mitosis is the division of one parent cell into two identical daughter cells with a complete set of…

Q: In the exponential phase of microbial growth, Log cell numbers Time 1 1 1 1 1 1 I 1 1 a) net cell…

A: Microbial growth curveThe microbial growth curve shows the pattern of microbial growth.There are…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.