Q: Calculate the number of grams needed to prepare 100 mL of a 0.20 M solution of cobalt sulfate…
A: 1 mole of a substance is equal to that substance's Molecular weight The molecular weight is cobalt…
Q: Fatty acids activate Thermogenin, UCP-1 Channel H Hº H H H H' UCP-1 disturbs proton gradient H Hº H+…
A: Aerobic cellular respiration involves production of energy in the presence of oxygen from the…
Q: Question 3 Part 1: Biological invasions have proliferated in recent decades because of increased…
A: An organism that has been introduced and has overpopulated and harmed its new environment is said to…
Q: What strategy does a genetically encoded calcium indicator look like to allow fluorescence imaging…
A: A crucial part of astrocyte physiology and function is Ca2+ signaling. Ca2+ imaging is the most…
Q: Which of the following is FALSE about fruit? A. Mature ovary B. Protect seeds and aid in dispersal…
A: Introduction : Angiosperms are flowering plants that produce fruits with seeds inside of them. They…
Q: At the very end of cellular respiration (glycolysis followed by pyruvate oxidation, the citric acid…
A: Cellular respiration is the process by which energy is produced by the breakdown of glucose. In…
Q: Which of the following is a tropic (stimulating) hormone? Group of answer choices Thyroxine…
A: Tropic hormones are the hormones that are produced by anterior pituitary. They helps to stimulate…
Q: Discuss in detail the inherited disorder in which affected individuals secrete abnormal body…
A: Cystic fibrosis is an autosomal recessive disorder, meaning that is not inherited solely from the…
Q: Which of the following statements is false? a mutation in a 5' or 3' splice site must alter the…
A: When genes occasionally undergo "mutations", which alter the instructions for forming the protein,…
Q: 7.13 In rabbits, the dominant allele C is required for colored fur; the recessive allele c makes the…
A: Introduction :- The relationship between two genetic variants is referred to as dominant. Each gene…
Q: Taxon Outgroup A B C D E Character 1 0 0 0 0 0 1 Character 2 0 0 0 0 0 1 Character 3 0 0 0 0 1 1…
A: Introduction Phylogenetics is the study of links between or among groupings of organisms and their…
Q: )One girl in every two has brown hair. One girl in every three has dimples. What is the probability…
A: A: Probability of 1 girl in every 2 having brown hair is 1/2.B: Probability of one girl in every…
Q: what are the goup of muscles that is working to allow a hip flexion in a squat?
A: Introduction Squats are a complex exercise. They therefore engage a number of lower body muscle…
Q: Besides real time PCR, Shania will also be using other variations of PCR; Multiplex PCR, Reverse…
A: Multiplex PCR used in temperature-mediated DNA polymerase in a thermal cycler. Multiplex PCR is…
Q: phospholipid that is destined to become part of the plasma membrane is synthesized inside a cell.…
A: There are some important points : Plasma membrane is a dynamic, fluid-structure and forms an…
Q: other diseases like Kwashiorkor Syndrome
A: Kwashiorkor: It is a condition which results from the inadequate protein intake. Initial symptoms…
Q: is energy is released when ATP loses a phosphate group true about ATP and ADP
A: ATP is the energy currency of the cell and is made up of adenine and ribose sugar with three…
Q: ) Why is Hot Start PCR technique preferred by some researchers?
A: Introduction A modified version of the common polymerase chain reaction (PCR), known as "hot start…
Q: Why do you think most bacteria grown in labs are mesophiles with a pH optimum for growth near 7.0,…
A: Mesophiles are a group of bacteria that grow well in the temperature of 20 degree Celcius to 45…
Q: Polymerase chain reaction (PCR) is a technique that enables multiplication of specific DNA sample at…
A: The polymerase chain reaction (PCR) was hugely successful in molecular biology. PCR tests are…
Q: A shuttle vector is a vector constructed so that it can propagate in two different host species. One…
A: Shuttle vector It refers to a vector—typically a plasmid—built to replicate in two separate host…
Q: On the diagram below, i) draw where the uncoupling protein must be located and ii) indicate the…
A: Electron transport chain: A series of protein complexes that are generally found in the outer wall…
Q: number
A:
Q: Multi-drug resistant tuberculosis is becoming more common because of The age of the hosts…
A: Mycobacterium tuberculosis is the bacteria that is responsible for causing tuberculosis (TB).…
Q: You finally received the gene sequence of a novel bacterial isolate. The supervisor required you to…
A: Bioinformatics is the study and use of biological information's complexities. Bioinformatics…
Q: Draw a strict consensus tree based on your tree and Tree 2. Circle all the polytomies.
A: The strict consensus tree is a tree where the included clades are those that are present in all the…
Q: EXAMPLE 2: The parents in the family above produce another son, this time with two Y chromosomes and…
A: Non disjunction is a event where either homologous chromosomes in meiosis I or sister chromatids in…
Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…
A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…
Q: An epidemiologist recruits 250 people for a cohort study. Of these potential study subjects, 11 are…
A: Cohort study A form of research design known as a cohort study observes groups of people through…
Q: Many invasion process models (including the framework in Blackburn et al. 2011) have emphasized that…
A: Invasion : Biological invasion is a process by which an organism introduced to and establishes a…
Q: For questions 1-3, suppose that in generation 0, the frequency of allele A1 in a population of…
A: Introduction The relative frequency of an allele (gene variant) at a certain locus in a population…
Q: Describe the stages of meiosis.
A: Introduction Meiosis is a unique form of germ cell division that creates gametes, such as sperm or…
Q: 1) Using Punnett Squares, determine which genotypes are possible at each gene locus if you cross…
A: Mendelian inheritance describes specific patterns of how features are passed down from parents to…
Q: explain the process of alcohol fermentation. having alot of touble understanding it
A: Fermentation is where microorganisms produce beneficial & desirable changes in food. The process…
Q: Deletion of these two genes resulted in the expression of multiple VSG's simultaneously. a.
A: Trypanosomes Deletion of these two genes resulted in the expression of multiple VSG's…
Q: The same restriction digestion experiment was repeated for EcoR1 on the same DNA molecule. However,…
A: It is given that the incubation period of the restriction digestion with EcoRI on the same DNA was…
Q: Which is the most important digestive enzyme in gastric juice
A: The most important digestive enzyme in gastric juice is pepsin. Gastric juice is formed in the…
Q: If C +T/A + G equals 0.5 in one strand, what is the ratio of these bases in the complementary…
A: Erwin chargaff in the year 1950 made quantitative analysis of DNA and showed that the composition of…
Q: what characteristics do you think make the "perfect fossil" to discover and for studying the past…
A: Fossils are the preserved remains of an organism. These are generally rocks in which organisms are…
Q: During the colony selection at the end of the cloning step, there is a possibility of encountering…
A: During colony screening, false colonies in the plates hinder the selection process, which is…
Q: Which of the following are major differences between DNA and RNA polymerases? RNA polymerase, but…
A: Both the polymerases are required for adding different nucleotides to the growing chain of the…
Q: A) Identify the structures that would be found in proteins B) identify the structures that…
A: Introduction Large biomolecules and macromolecules known as proteins are made up of one or more…
Q: When two molecules of glucose go through glycolysis, how many molecules of pyruvate are formed? a.…
A: Please follow step 2 for detailed explanation.
Q: II. Cultural characteristics of yeasts. Below is the colony diameter for each yeast culture grown on…
A: Yeasts are single-celled, eukaryotic microorganisms that belong to the fungal kingdom. There are…
Q: 2. Human activity can be very disruptive to an ecosystem. Part of the forest shown in the picture…
A:
Q: An anticodon strand reads 5'-IAG-3'. Fill in the missing base sequences for the possible codons…
A: The anicodon is 5' IAG 3' so the codon for this anticodon would be 5' TGC 3' if the I were to be…
Q: Describe the feeding biology of centipedes, spiders, mites and beetles. Compare and contrast these…
A: We know that centipedes, spiders, mites, and beetles belong to the phylum Arthropoda and which is…
Q: HS IP: FLAG-KDM3A SIA - WT + Lane Number: 1 2 3 S/D 4 5 6 Stat1 FLAG
A: KDM3A phosphorylation after 30 or 60 minutes of heat shock at 42°C (heat shock (HS) is generally…
Q: Differentiate among between Northern, Southern and Western blotting techniques.
A: Answer Difference between Northern , Southern and Western blotting is under : 1) Northern blotting…
Q: Caenorhabdiris elegant posses motor neurons called MNs. It has been determined that few cells known…
A: Neurons are the fundamental units of the brain and nervous system. These are the cells responsible…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- WRITE ABOUT A THEME: ORGANIZATION As you read inthis chapter, fungi have long formed symbiotic associationswith plants and with algae. In a short essay (100–150 words),describe how these two types of associations may lead toemergent properties in biological communities.Which of the following is an example of a symbiosis between an Ascomycete and a green algae? Group of answer choices Ferns Rhizobium and Plants Lichens Mycorrhizal Fungi and Plants HornwortsResearch an interesting example of mutualism, and present your findings in a post. The goal here is to provide examples beyond what is presented in lecture and/or your textbook. These can be animal-animal, animal-fungal, plant-fungal, plant-animal, bacteria-animal....the sky is the limit! For this particular forum, you'll be able to see other classmates postings even before you post your own. This is so you can present an example that's different from what's already been discussed. Remember that mutualistic interactions are associations that benefit both parties -- so your response should clearly indicate the role each partner plays. Let us know where these organisms are found, what kind of habitat they live in, and any other interesting , pertinent information. Also, please comment on how natural selection likely played a role in the development of your example. You can use your imagination a bit here -- I'd just like to see you connect the ideas. Your posting must be at least…
- SCIENTIFIC INQUIRYINTERPRET THE DATA The feather moss Pleurozium schreberiharbors species of symbiotic nitrogen-fixing bacteria.Scientists studying this moss in northern forests found thatthe percentage of the ground surface “covered” by the mossincreased from about 5% in forests that burned 35 to 41 yearsago to about 70% in forests that burned 170 or more years ago.From mosses growing in these forests, they also obtained thefollowing data on nitrogen fixation: Age(years after fire) N fixation rate[kg N/(ha · yr)] 35 0.001 41 0.005 78 0.08 101 0.3 124 0.9 170 2.0 220 1.3 244 2.1 270 1.6 300 3.0 355 2.3If all of the saprophytic fungi in an ecosystem died, which of the following would be a likely short-term result? Group of answer choices Plants would not be able to absorb nutrients from the soil as effectively Dead plant material would be decomposed more quickly, releasing higher levels of CO2 Less carbon dioxide would be released into the atmosphere because dead plant material would not be decomposed Plants would be unable to absorb nitrogen as efficiently because their root symbiotic fungi would be unable to break gaseous nitrogen apart Plants would be unable to absorb nitrogen as efficiently because their root symbiotic fungi would be unable to break gaseous nitrogen apartSharks and bony fish are classified within the phytoplankton because they are often found in the well- surface areas of the ocean .
- If a symbiotic relationship between a fungus and its host plant is said to be commensal, what does this mean? Group of answer choices the fungi benefit, but the plant is unaffected the fungi are harmed and the plant benefits the plant is harmed and the fungi benefits both plant and fungi benefitWhich of the following pairs that relate to terrestrial environmentsdoes not match?a) Soil—minimal biodiversityb) Bacillus —endosporesc) Streptomyces —geosmin productiond) Fungi—lignin degradatione) Rhizosphere—soil that adheres to plant rootWhat is the term for the symbiotic association between fungi and cyanobacteria? a. lichen b. mycorrhizae c. epiphyte d. nitrogen-fixing nodule
- Mountain yellow-legged frogs live in the Sierra Nevada mountains.Their tadpoles mainly eat algae. One predator of adult frogs is a gartersnake, which is eaten by bullfrogs. Recently, a chytrid fungus haskilled many adult mountain yellow-legged frogs. How might thischange affect the algae, garter snakes, and bullfrogs?Mycorrhizal fungi live in the soil and interact with the roots of plants. Essentail nutrients (e.g. nitrogenous compounds) are taken from the soil by the fungi and transferred to the plant roots. The fungi extract carbohydrates from the plant roots. What type of interaction is occurring? Group of answer choices commensalism predation competition mutualismMarine Biology a) Despite being so large, the ocean contributes to (more or less) primary production because it is__________, which means it doesn't have very many nutrients. Even so, _______________can survive her and absorb the few nutrients because they are____________. Small things have more_____________ b) cyanobacteria were the first to produce oxygen and form stromatolites made of ______________