25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3 3 CCATGGS 3CCATGGS 5' GGTACC3 Kpnl Acc651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.

25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3 3 CCATGGS 3CCATGGS 5' GGTACC3 Kpnl Acc651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 3TYK: Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning...

See similar textbooks

Similar questions

Match the method with the appropriate enzyme. _____ PCR a. Taq polymerase _____ cutting DNA b. DNA ligase _____ cDNA synthesis c. reverse transcriptase _____ DNA sequencing d. restriction enzyme _____ pasting DNA e. DNA polymerase (not Taq)
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
1. Given the following restriction endonucleases and the sequences of their corresponding restriction sites, which would be LEAST useful for cutting the plasmid and the foreign DNA to be inserted? [The arrows indicate where cuts are made.] (see img) a. EcoRI b. HindIII c. HaeIII d. BamHI 2. EcoRI and HindIII are two different restriction enzymes. If the DNA from two different sources were cut with either EcoRI or HindIII, which of the cut DNA fragments would NOT join together easily so that they could be sealed with ligase? a. E. coli DNA cut with EcoRI and human DNA cut with HindIII b. E. coli DNA cut with HindIII and mouse DNA cut with HindIII c. human DNA cut with EcoRI and chimpanzee DNA cut with EcoRI d. mouse liver DNA cut with HindIII and mouse kidney DNA cut with HindIII
27. You have a DNA sequence of 1400 bp. To characterize it, you decide to make a restriction map. Cutting with the first enzyme, you show by electrophoresis that the fragments produced are 400 and 1000 bp, respectively. After using the second enzyme, you recover 600-bp and 800-bp fragments. After treatment with both enzymes, fragments were 200, 400, and 800 bp. Draw the correct restriction map.
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?
1. Below is an illustration of two plasmids: the incomplete pKAN-R which contains the gene of interest (rfp), and the good plasmid vector pARA which contains the ampR gene for ampicillin resistance, the araC activator gene and the ori region. Based on this, how are you going assemble to create the desired recombinant plasmid containing all the necessary components? (Keywords: Identify correct restriction enzymes to use to create specific sticky end sequences that will only assemble with the final vector in one orientation)
1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizes
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions.a. PscI & GsuIb. ScaI, PdmI & BsaXI c.ScaI, SspI & EheI
The restriction endonuclease BamHI recognizes the sequence GGATCC and cleaves between the Gs (in both strands). The enzyme Bgl II recognizes AGATCT and cuts between AG (in both strands). Justify your answers. 1. Draw the double stranded sequences of the DNA pieces shown above and indicate with an arrow the cutting points for each of the enzymes. Use different two colors for the two different sequences (one color for BamHI and another one for BglII). Do they generate blunt ends or sticky ends? 2. Draw the two sequences arising from each the cut (there will be four sequences).
You isolated a 10,500 base pair plasmid (supercoiled, cccDNA) from E. coli. The plasmid contains one unique recognition site for EcoRI, a restriction enzyme. Restriction enzymes recognize a specific sequence and cut both strands of the DNA at that sequence (Chapter 7). Brief DNase I treatment breaks one (or very few) phosphodiesterbonds in each DNA molecule, leaving the double-stranded DNA with one strand broken but the other strand intact, i.e “nicked.” You briefly incubated the cccDNA at 37°C in four separate reactions containing the components listed below. You ran each reaction sample on an agarose gel and visualized the DNA using ethidium bromide and UV light. The reactions included the appropriate buffer and ATP when required. An agarose gel containing four lanes of possible products is given below. Please refer to Figs. 4-26 and 4-27 in Watson for reference. For each reaction, indicate which lane of the gel contains the products that you would expect to see on your…