3. The trp repressor is a homodimer with 107 amino acid residues per monomer. The content of proton dissociable groups of each monomer is given below: Side chain pKa number/monomer ZpH 4 ZpH 6 Arginine Aspartate Glutamate Histidine 12.5 4.0 4.0 9. 10 6.0 10.0 Lysine Tyrosine -NH3® —СООН 9.5 2 7.0 4.0 1 1 (a) (' : ) The isoelectric point (pl) of the protein, i.e., the pH at which the overall electrostatic charge on the protein E z = 0, is 5.3. Although the pKa values in the table above are only approximate values generally characteristic of residues with unhindered exposure to solvent, confirm that the overall charge on the protein must pass through zero between pH 4 and pH 6.

3. The trp repressor is a homodimer with 107 amino acid residues per monomer. The content of proton dissociable groups of each monomer is given below: Side chain pKa number/monomer ZpH 4 ZpH 6 Arginine Aspartate Glutamate Histidine 12.5 4.0 4.0 9. 10 6.0 10.0 Lysine Tyrosine -NH3® —СООН 9.5 2 7.0 4.0 1 1 (a) (' : ) The isoelectric point (pl) of the protein, i.e., the pH at which the overall electrostatic charge on the protein E z = 0, is 5.3. Although the pKa values in the table above are only approximate values generally characteristic of residues with unhindered exposure to solvent, confirm that the overall charge on the protein must pass through zero between pH 4 and pH 6.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

62) If you want to inhibit protein synthesis on the transcriptional level you would use: a) Tetracyclin b) Vancomycin c) Macrolides d) Fluroquinolones e) a & c 63) The protein that prevents the formation of off-centered septation in bacteria is: a) FtsZ b) MreB c) MinCD d) Tubulin e) Septin 64) The autoclave pressure must reach at least ________ in order to effectively kill the bacterial spores: a)15 psi b) 15 Joules c) 15 Kilograms d) 15 Lbs e) 15 Kilocalories 65) Incineration is a type of ______ method in controlling bacterial growth: a) moist heat b) dry heat c) chemical d) chemotherapeutic e) genetic.
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive 14C-cysteinyl-tRNACys (charged tRNACys + cysteine). They then removed the sulfur group from the cysteine, creating alanyl-tRNACys (charged tRNACys + alanine). When alanyl-tRNACys was added to a synthetic mRNA calling for cysteine, but not alanine, a polypeptide chain was synthesized containing alanine. What can you conclude from this experiment?
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
Which of the following anticodons could be charged with Asparagine (Asn)?Question 23 options: A) 3' AAU 5' B) 3' UUA 5' C) 3' UUG 5' D) 3' UUI 5' E) all can be charged with Asn except 3' AAU 5'
Which of the following statements regarding Anfinsen's denaturing experiments with ribonuclease A are valid? (i) Exposing the denatured protein to air oxidation and then dialysis to remove urea restored the protein to its original functionality. (ii) Removing urea by dialysis and then allowing air oxidation of the denatured protein restored the protein to its original functionality. (iii) Denaturing the protein with both urea and β-mercaptoethanol yielded an inactive protein. (iv) Protein folding is determined by its primary sequence.
A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?