3. You have assembled a very short contig below, but you don’t know if this is the sense or antisense strand. Determine the mRNA sequence in either case, and then provide a 6 frame translation. 5' - ATACGGGCAATTACAGTCTAGA – 3' If this is the sense (+) strand, what is the corresponding mRNA sequence? If this is the antisense (-) strand, what is the corresponding mRNA sequence? For BOTH mRNA sequences you just determined, provide a 3 frame translation for each (i.e. a 6 frame translation, in total)

3. You have assembled a very short contig below, but you don’t know if this is the sense or antisense strand. Determine the mRNA sequence in either case, and then provide a 6 frame translation. 5' - ATACGGGCAATTACAGTCTAGA – 3' If this is the sense (+) strand, what is the corresponding mRNA sequence? If this is the antisense (-) strand, what is the corresponding mRNA sequence? For BOTH mRNA sequences you just determined, provide a 3 frame translation for each (i.e. a 6 frame translation, in total)

Name: 3. You have assembled a very short contig below, but you don't know i
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 3. You have assembled a very short contig below, but you don't know if this is the sense orantisense strand. Determine the mRNA sequence in either case, and then provide a 6frame translation.5' - ATACGGGCAATTACAGTCTAGA – 3'If this is the sense (+) s

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A. 5’-CGU-UAC-AGG-CCA-3’ B. 3’-CGU-UAC-AGG-CCA-5’ C. 5’-CGT-TAC-TGG-GCA-3’ D. 3’-CGT-TAC-TGG-GCA-5’ 2. Which is the correct amino acids using the mRNA strand of 5’-AUG-CAU-CAA-3’? A. MET-HIS-GLN B. GLN-HIS-MET C. MET-GLN-HIS D. HIS-MET-GLN
4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.
1.A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine 2. Active transcription does not occur in regions of chromatin loops that are located ________. Group of answer choices a. A large distance away from the MARS b. Within the euchromatin c. Near the MARS d. A large distance from the telomere 3. Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent mutation? Group of answer choices a. 5′-AUG GUU AGA GUU GAA AAA-3′ b. 5′-AUG GCU UGA GUU GAA AAA-3′ c. 5′-AUG GCU AGA GUU GGA AAA-3′ d. 5′-AUG GCU CGA GUU GAA AAA-3′
1) Below are some events that occur in the process of translating mRNA into a protein in a bacterial cell. Pick the best order of events. EF-G–GTP binds to the tRNA in the A site and causes the tRNA to advance to the P site.- The rRNA in the ribosomal 30S subunit base-pairs with the Shine-Dalgarno sequence in the mRNA.- Peptide bond forms between the growing amino acid chain in the P site and the new amino acid in the A site.- IF-3 binds in the E site.- RRF binds in the A site.- RF-1 or -2 binds in the A site.- Ribosomal complex dissociates.- Peptide chain dissociates from final tRNA.- fMET tRNA binds to the start codon in the mRNA.- RF-3–GTP causes displacement of RF-1 or -2 and its exit from the ribosome.- EF-G–GTP binds to the A site and causes RRF to shift to the P site.- A conformational change in the 30S subunit allows the 50S subunit to bind, forming the 70S ribosome. Step 1, 2, 3, 4 ,5 ,6 , 7, 8, 9, 10, 11, 12
1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asap