30  A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide. Please explain step-by-step how exactly you go from the DNA sequence given to the final answer.

Q: What are Redox Reactions?

A: A redox reaction is a shorthand for oxidation-reduction reactions and is a chemical reaction in whic...

Q: What are the cardinal signs of inflammation and what causes them?

A: Inflammation is a response which is triggered by damage to living tissues. Inflammatory reponse is a...

Q: I want to make sure I did part h right.

A: Karyotyping is the process of taking photographs of chromosomal pairs to determine the number of chr...

Q: Discuss the importance of redox reactions in the metabolism of glucose. Be sure to address nicotinam...

A: Cellular respiration involves many reactions where electrons are passed from one molecule to another...

Q: ATP is an example of which of the following. A pentose sugar An RNa nucleotide An amino acid with t...

A: ATP stands for Adenosine Triphosphate. It is the principal molecule for storing and transferring ene...

Q: How does the search for the neural correlates of consciousness bypass the hard problem?

A: Hard problem is the difficulty in explaining the reason for which some internal states such as heat ...

Q: The mitotic spindle plays a critical role in which of the following processes? a) dissolving the nuc...

A: Mitosis process of cell division starts with interphase. During interphase, the cell gets ready with...

Q: Conjugation: Diagram the process of conjugation in bacterial cells (using F plasmid transfer):a. In ...

A: The transfer of genetic material from one bacterial cell to another bacterial cell by direct contact...

Q: NADH is reozidized by which if the following processes?  A. Glycolysis  B. Fermentation  C. Krebs cy...

A: Reoxidation can be defined as subsequent oxidation.