30- lacz 20- 10 galE 0- 10 16 20 25 30 40 50 Duration of conjugation (minutes) Time course of an interrupted E. coli conjugation experiment. By extrapolating the data back to the origin, the approximate time of entry of the lacz gene is found to be 16 minutes; that of the gale gene, 25 minutes. Therefore, the distance between these two genes is 9 minutes. % of F" reciplent cels that have recelved the gene during conjugaton

30- lacz 20- 10 galE 0- 10 16 20 25 30 40 50 Duration of conjugation (minutes) Time course of an interrupted E. coli conjugation experiment. By extrapolating the data back to the origin, the approximate time of entry of the lacz gene is found to be 16 minutes; that of the gale gene, 25 minutes. Therefore, the distance between these two genes is 9 minutes. % of F" reciplent cels that have recelved the gene during conjugaton

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 2DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: On what basis did the authors conclude that evidence ofhorizontal transfer is absent from their data?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: What is meant by ”horizontal transfer”?
Price et al. (1999. J. Bacteriol. 181: 2358–2362) conducted a genetic study of the toxin transport protein (PA) of Bacillus anthracis, the bacterium that causes anthrax in humans. Within the 2294-nucleotide gene in 26 strains they identified five point mutations—two missense and three synonyms—among different isolates. Necropsy samples from an anthrax outbreak in 1979 revealed a novel missense mutation and five unique nucleotide changes among ten victims. The authors concluded that these data indicate little or no horizontal transfer between different B. anthracis strains. (a) Which types of nucleotide changes (missense or synonyms) cause amino acid changes? (b) What is meant by horizontal transfer? (c) On what basis did the authors conclude that evidence of horizontal transfer is absent from their data?
When Meselson and Stahl grew E. coli in 15N mediumfor many generations and then transferred the cells to 14Nmedium for one generation, they found that the bacterial DNA banded at a density intermediate between that ofpure 15N DNA and pure 14N DNA following equilibrium density centrifugation. When they allowed thebacteria to replicate one additional time in 14N medium, they observed that half of the DNA remained atthe intermediate density, while the other half banded atthe density of pure 14N DNA. What would they haveseen after an additional generation of growth in 14Nmedium? After two additional generations?
SARS-CoV-2 has 30,000 nucleotides? How long is this compared to bacterial genomes and to human genomes.
35. In five Hfr strains, each of which was used to build a time-of-entry map, the genes entered the recipient cells as follows: Strain 1: N O S S N A Strain 2: A P T H A N Strain 3: P T H A N O Strain 4: A N O S S N Strain 5: N A P T H A Build the map from this data and enter your result.
28. What type of mutation is seen here? WT: 5′-AUG GCU AGA GUU GAA AAA-3′ Mutant: 5′-AUG GGU AGA GUU GAA AAA-3′ Group of answer choices 1. Tranversion 2. Deletion 3. Transition 4. Insertion
28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…
Question:- In an early log-phase E. coli population, there are 1 x 103 cells/ml the generation time of the cells is 30 minutes. How many cells would there be 60 minutes later? a. 2X10^6b. 8X10^3c. 4X10^3d. 2X10^3e. 3X10^6
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
The terms conjugation, transduction, and transformation are usedto describe three different natural forms of genetic transferbetween bacterial cells. Briefly discuss the similarities and differencesamong these processes?
1) When Meselson and Stahl grew Escherichia coli in 15N medium for many generations and thentransferred the cells to 14N medium for one generation, they found that the bacterial DNA banded ata density intermediate between that of pure 15N DNA and pure 14N DNA following equilibrium densitycentrifugation. When they allowed the bacteria to replicate one additional time in 14N medium, theyobserved that half of the DNA remained at the intermediate density, while the other half banded atthe density of pure 14N DNA. What would they have seen after an additional generation of growth in14N medium? After two additional generations? 2) Draw a diagram of replication that is occurring at the end of a double-stranded linear chromosome.Show the leading and lagging strands with their primers (indicate the 5′ and 3′ ends of the strands).What difficulty is encountered in producing copies of both DNA strands at the end of a chromosome?