6. Which of the following statements concerning the BLOSUM62 substitution matrix is correct? a. Ala is aligned with Arg more often than expected by chance. b.Ala is never substituted by Cys. c. Tryptophan is substituted less frequently than any other amino acid.

6. Which of the following statements concerning the BLOSUM62 substitution matrix is correct? a. Ala is aligned with Arg more often than expected by chance. b.Ala is never substituted by Cys. c. Tryptophan is substituted less frequently than any other amino acid.

Name: 6. Which of the following statements concerning the BLOSUM62 substitut
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 6. Which of the following statements concerning the BLOSUM62 substitution matrix is correct?a. Ala is aligned with Arg more often than expected by chance.b.Ala is never substituted by Cys.c. Tryptophan is substituted less frequently than any other am

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 4TYK

See similar textbooks

Similar questions

6. Please describe the events that may result in a mature protein not having methionine asthe N-terminal amino acid.
1. Search for the `P06858` a) Give information about the PTM and Processing of this protein. b) Which position has maximum amount of variations? Give details about the variations. (Eg: What kind of variation? Feature ID? Disease association? etc..)
1. What happen to the mutated sequence in the coding region of MT-ATP6 in Leigh's syndrome. Does it lead to amino acids substitution? Illustrate the process
1. Suppose Biuret test is conducted to a solution of RNA. Will it give a positive result or not? Explain your answer. ____________________________________________________________________ ____________________________________________________________________ 2. Why is Molisch’s test used for the determination of presence of pentose in the hydrolysate? What other test could be used for this? ____________________________________________________________________ ____________________________________________________________________
1. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. ATG GCA TGC AAT AGC TCA TGC 2. What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A?
4. The strength of ligand-protein binding is a property of the binding site called --------------
7. Which of the following events does NOT take place in/on the RER? a. cleavage of the signal recognition peptide b. biosynthesis of core oligosaccharides for N-linked glycosylation c. Phosphorylation of mannose to give rise to mannose-6-phosphate. d. attachment of a core oligosaccharide to protein via asparagine residues e. cleavage of GTP by SRP receptor
1. a)how is it possible for such drugs to selectively kill bacterial cells and not our own cells? b)Provide an example of post-translational regulation of protein activity and explain the advantage of regulating each protein/process at the post-translational level instead of the transcriptional level.
3. List the amino acid sequence of the protein coded for. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
1. What determines the affinity of a glycan for a GBP?
1.What is the chemic name and formula of the precipitate for the test for phosphate? 2.suppose biuret test is conducted to a solution of RNA. Will it give a positive result or not? Explain answer.
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.