8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume this shows the middle of a mRNA sequence (so you don't need to look for a start or stop codon). 3' C DNA double helix G A 3' MRNA (codons) A U TRNA (anticodons) 3' A amino acid Trp

8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume this shows the middle of a mRNA sequence (so you don't need to look for a start or stop codon). 3' C DNA double helix G A 3' MRNA (codons) A U TRNA (anticodons) 3' A amino acid Trp

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Related questions

Q: In problem 2e, how can you identify added mutations?

A: Mutations are changes in the base pairs of DNA that are heritable to the offspring. Mutations caused…

Q: 5. Consider the following DNA template strand: 3’ GCA- AAA-CAA-ATA-GTG 5’ Using the following…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…

A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…

Q: 1. Imagine that you are analyzing a DNA sample from the liver tissue of a newly discovered species…

A: Since you have asked multiple question, and need help in 1 & 2, we will solve the first and…

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: 1. Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base;…

A: DNA replication is a mechanism that involves breaking and building bonds. Replication occurs in 3…

Q: 26. Directions: 1st Fill in the complimentary DNA strand using DNA base pairing rules. 2nd Fill in…

A: Reverse transcriptase, a DNA polymerase which can use either DNA or RNA as a templates, creates…

Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTRY by Smith 4th Edition

A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…

Q: 4. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leader…

A: We all know that Central dogma of life is a unidirectional flow of information from master copy DNA…

Q: 1. Below is an amino acid sequence for the following strand of DNA: A G C A A T C C G T C T T G G T…

A: Ans 1 : Point mutation

Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…

A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…

Q: Fill in the following information for making the following polypeptide (the codon chart is below).…

A: The sequence of nucleotides in DNA or RNA makes up the genetic code. Codons are three-base groups…

Q: 3. The following segment of DNA is the template strand: 5'-.GACATGGAA.-3' a. What is the sequence of…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: 7. Fill in the following table. Acid TRNA MRNAI DNA DNA amino sense anti-sense UGA UGA, Histidine…

A: Transcription: It is the process through which the enzyme RNA Polymerase transfers information from…

Q: 1.Which of the following RNA has a catalytic activity like an enzyme? A. MRNA C. FRNA B. tRNA D.…

A: 1. (C) rRNA 2. (A) deoxythymidine 5'-monophosphate 3. (B) they differ in pitch

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…

A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…

Q: Locate as accurately as possible the listed items that are shown on the following figure. Some items…

Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…

A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…

Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Which of the following are involved in translation? Choose all that apply tRNA DNA ribosome…

A: The correct answer is t RNA, Ribosome, Amino acid, mRNA, rRNA

Q: Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient…

A: A)

Q: Complete the table below showing the sequences of DNA, MRNA codons, RNA anticodons and the amino…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…

A: Biochemistry is a branch of biology that deals with the structure, function and interaction of…

Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…

A: Answer a. The sequence of the strand of DNA it would be paired within a double-stranded helix is…

Q: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

A: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

Q: 8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time…

A: Answer : Given in the image

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 8. Which RNA molecule is NOT involved in the processes of transcription and translation? A.…

A: RNA or Ribonucleic acid is a type of nucleic acid. Transcription is the process of synthesis of…

Q: PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the…

A: the three-letter genetic code is the way by which the cell transcript the information from DNA to…

Q: 3. Which of the following represents a similarity between RNA and DNA? A. The presence of Uracil…

A: DNA and RNA are both very essential biopolymers that sustain life. It is present in all forms of…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…

A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…

Q: 4. (a) Create the complementary strand for the DNA strand below. Make sure to write the direction of…

A: DNA is a polynucleotide molecule that stores genetic and hereditary information. DNA is a…

Q: Locate as accurately as possible the listed items that are shown on the following figure. Some items…

A: The process of making a protein from the information contained in a molecule of messenger RNA is…

Q: 4)Which of the following have codons? Choose all that apply DNA RNA polymerase proteins tRNA…

A: Codons are the set of three nucleotides which encode a particular amino acid.

Q: 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA.

A: 7. In all living organisms, the material that contains the information which is transmitted from…

Q: Determine what amino acid will be formed from the given DNA strand below:…

A: Determine what amino acid will be formed from the given DNA strand below:…

Q: Locate as accurately as possible the listed items that are shown on the following figure. Some items…

A: The diagram shown indicates protein synthesis , process known as translation .

Q: 6. If you are given the DNA sequence: T-A-C-C-G-A-A-T determine the complementary RNA strand.

A: Introduction :- The term "DNA sequencing" refers to a common laboratory procedure for determining…

Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…

A: The central dogma of life involves three processes. They are: Replication: - In this process,…

Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…

Q: 1. One strand of DNA has the base sequence: C G A T T G G C A G T C A T. Determine the sequence of…

A: According to the question, one strand of DNA with the base sequence is given, we have to determine…

Q: 3. Illustrate a 15 nucleotide DNA molecule. Use the symbols: P for phosphate, S sugar and N…

A: DNA is a polymer of nucleotides which are linked to each other by 3'-5' phosphodiester bond.

Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…

Q: )Which of the following statements are true? Choose all that apply a)There are multiple codons…

A: The DNA expression involves the protein synthesis which involves a series of events primarily the…

Q: Which of the following carries amino acids?

A: Ribonucleic acid (RNA) is a single stranded nucleic acid found in all living cells. Its different…

Question

8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume this shows the
middle of a mRNA sequence (so you don't need to look for a start or stop codon).
3'
C
DNA double helix
GA
3'
т
MRNA (codons)
A
U
TRNA (anticodons)
3'
CA
amino acid
Trp

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino Acids
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand in mRNA. Label the 5’ and 3’ ends. Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
1. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA anticodons for each of the mRNA codons (c) The sequence of amino acids in the resulting polypeptide. (d) Provide the sequence of another possible DNA strand that will lead to synthesis ofthe same polypeptide.