α-Amanitin is a poison found in the mushroom Amanita phalloides, and this is the most common form of mushroom poisoning in the world. What is the mechanism of action of α-Amanitin on RNA polymerase?

α-Amanitin is a poison found in the mushroom Amanita phalloides, and this is the most common form of mushroom poisoning in the world. What is the mechanism of action of α-Amanitin on RNA polymerase?

Name: Give typing answer with explanation and conclusion α-Amanitin is a poi
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Give typing answer with explanation and conclusion α-Amanitin is a poison found in the mushroom Amanita phalloides, and this is the most common form of mushroom poisoning in the world. What is the mechanism of action of α-Amanitin on RNA polymerase?

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 5CT: Translate the sequence of bases in the previous question, starting at the second base.

See similar textbooks

Similar questions

Give typing answer with explanation and conclusion What is the transcription product of the DNA templa GCTAGCGATGAC-5'? OA) CAGTAGCGATCG OB) CGAUCGCUACUG OC) CGATCGCTACUG OD) CGUTCGCUTCUG
Give typing answer with explanation and conclusion During an experiment, a student attempts to synthesize a protein by inserting a gene of interest, tal-2, into a cloning vector of E. coli. What would happen if DNA ligase was omitted from the manipulation?
Give typing answer with explanation and conclusion In eukaryotes, repressors can function by: Select one: binding to the regulatory promoter blocking DNA polymerase binding binding to the polyA tail blocking ribosome binding
Give typing answer with explanation and conclusion to all parts The pairing of the U1 snurp and the donor site signals what particular event? A. Identify the donor splice site. B. Identify/recognize intron. C. Keep the U6 RNA free from binding to the U1 RNA. D. Base pair with the nucleotides in the Branch site. E. De-branch the lariat and release the intron.
Give typing answer with explanation and conclusion What is the trinucleotide sequence that is unstable and expands in Friedreich’s Ataxia? Explain what the different health and evolutionary consequences for the expansion of a trinucleotide repeat within coding sequences and dinucleotide repeat in non-coding sequences are.
Give typing answer with explanation and conclusion What is the complete base composition of a double-stranded eukaryotic DNA that contains 23 % adenosine?
Give only typing answer with explanation and conclusion Recombinant human insulin produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes. The human insulin gene encodes an mRNA only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns 1. Every cell in the human body has the same DNA, so very cell has an insulin gene. However in order to use the technique, you described in b, you would have to start with cells from the pancreas the only body cells that actually produce the insulin protein. Why are these the only cells that would work.
Give typing answer with explanation and conclusion Suppose that RNA polymerase was transcribing a eukaryotic gene with several introns all contained within the coding region. In what order would the RNA polymerase encounter the elements in the DNA sequence of the gene? Earliest encountered promoter 5' UTR translation initiation codon splice branch point stop codon 3' UTR Latest encountered
Give typing answer with explanation and conclusion Which description applies to alternative mRNA splicing? 1. heritable changes in gene expression that occur without altering the DNA sequence 2. processing of exons in mRNA that results in a single gene coding for multiple proteins 3. mRNA modifications such as additions of a 5′‑cap and 3′ poly‑A tail and removal of introns 4. a gene cluster controlled by a single promoter that transcribes to a single mRNA strand 5. protein modifications such as addition of a functional group or structural changes such as folding Answer 2 is correct.
Give typing answer with explanation and conclusion With an example explain how SNPs may and may not alter the protein sequence?
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
Give typing answer with explanation and conclusion What is a codon?