(а) (b) (c) 3' (d) 5 (е)

Q: Spectroscopy is a useful tool to determine the concentration of DNA in a solution by measuring the…

A: Spectroscopy is a field of analytical biochemistry that enables us to conduct tests on quantitative…

Q: The nucleoside consists of a D-deoxyribose and a cytosine base is called ______. A. cytidine B.…

A: Nucleoside term was used in 1909 to denote compounds from the yeast nucleic acid hydrolysates.Now a…

Q: Imagine two DNA duplexes X and Y. According to calculations using the nearest neighbor method the…

A: Given two DNA duplexes.  X and Y Standard enthalpy of helix formation is same for both.  Standard…

Q: a) In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of the three possible)…

A: Since you have asked multiple questions with multiple parts, we will answer only the first three…

Q: The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T,…

A: Most organisms contain DNA or deoxyribonucleic acid as their genetic material. It is a type of…

Q: Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more…

A: DNA is supercoiled structure which is present inside the nucleus The coiling of Dna is done by the…

Q: DNA molecules of different sizes are often separated with the use of a technique called…

A: Electrophoresis is a technique that is used to separate molecules based on their sizes.

Q: Ethanol promotes bonding between Na+ ions from the salt and charged phosphate group of the DNA due…

A: DNA extraction is a molecular process that involves extraction of DNA from biological samples. It…

Q: DNA solution is viscous because of the nature of chemical substance that can intercalate into the…

A: - Acridine orange is a cell-permeable, nucleic acid-sensitive fluorescent dye that can interact with…

Q: A mixture of four a-[3?P]-labeled ribonucleoside triphosphates was added to permeabilized bacterial…

A: It's an experiment for the DNA replication process.

Q: Consider the equation below. What are its consequences in the context of an electrophoresis…

A: Electrophoresis is a technique used in laboratories to separate DNA, RNA, and protein molecules…

Q: Which part of a deoxynucleoside triphosphate (dNTP) molecule provides the energy for DNA synthesis?

A: DNA stands for deoxyribonucleic acid. It stores the genetic information in form of nucleotides.

Q: During DNA replication, an incoming nucleotide is enzymatically joined to the preceding nucleotide…

A: Phosphodiester bond Explanation:-In DNA and RNA, the phosphodiester bond is the linkage between the…

Q: Describe the function of the following reagents used in the DNA extraction procedure?

A: Proteinase K is very useful for isolating undamaged DNA or RNA. DNA is insoluble in isopropanol. It…

Q: Watson and Crick used an approach called model building to deduce the structure of the DNA double…

A: DNA structure was not clear before 1950s. At the beginning of 1950s, James Watson and Francis Crick…

Q: hat role do deoxyribonucleotide triphosphates (dNTP) in DNA replication?

A: The process of replicating a double-stranded DNA molecule into 2 identical DNA molecules is known as…

Q: DNA sample which is approximately 600 base pairs long. What percentage of Agarose would you make…

A: The biochemical molecule that is built up with two polynucleotide chains is called DNA…

Q: If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and…

A: Given:  A piece of the partially double-stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA…

Q: Write a balanced equation for the hydrolytic deamination of a DNA- 5-methylcytosine residue.

A: Deamination is the process of breaking down amino acids in which amino group is converted into…

Q: Show the expected labeled cleavage products if the following DNA segment were subjected to each of…

A: D.N.A. Cleavage ---  A cleavage of single - stranded DNA oligonucleotides in the presence of ionic…

Q: It was once thought that the DNA polymerase machinery moves along DNA in a manner analogous to a…

A: DNA polymerase is defined as the family of enzymes responsible for catalyzing the synthesis of new…

Q: You have discovered an enzyme secreted by a particularly virulent bacterium that cleaves the C2′—C3′…

A: Introduction: DNA, also known as deoxyribose nucleic acid is made up of nucleotides which comprises…

Q: DNA polymerase I, DNA ligase, and topoisomerase I catalyze the formation of phosphodiester bonds.…

A: The DNA replication is a semi-conservative mechanism in which the new complementary strand is…

Q: What entropic factor destabilizes helical DNA at high temperature?

A: The double (ds) stranded DNA undergoes structural changes also known as denaturation at high…

Q: Describe the d=features of the following DNA-binding domains and how they interact with DNA.…

A: DNA-binding domain abbreviated as DBD is a protein domain that is folded independently and contains…

Q: A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following…

A: Multiple copies of DNA copies can be achieved with the polymerase chain reaction in large amounts of…

Q: A solution  containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3…

A: In biology, DNA replication is that the process of forming 2 identical replicas of deoxyribonucleic…

Q: Terminators The addition of an excess of ddNTP leads to the stop of DNA replication in bacteria:…

A: DNA replication is a process, in which incoming nucleotide phosphates are incorporated and a long…

Q: Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G]= [C], equalities now…

A: Erwin Chargaff proposed two rules which are termed as Chargaff's rule. These rules played an…

Q: Considering the principle of complementary base pairing, you would expect an equal ratio of which…

A: Chargaff's rules define that any DNA irrespective of species or organism has a 1:1 stoichiometric…

Q: Kornberg showed that nucleotides are added to the 3' end of eachgrowing DNA strand. In what way does…

A: It is majorly present within the nucleus. DNA can exist in different levels of complexity.  Primary…

Q: Write a balanced equation for the hydrolytic deamination of a DNA-5- methylcytosine residue.

A: Deamination reaction is the removal of an amino group from an amino acid and this reaction was…

Q: solution containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3…

A: In this reaction, we have used dideoxyadenosine triphosphate. Hence, the reaction will stop at all…

Q: A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a…

A: Melting temperature is the point at which 50% of double-helical DNA is changed into a…

Q: You are investigating the DNA-binding interaction of the drug candidate below, which binds to DNA…

A: The study of interaction between drug and protein is very important to understand its mechanism of…

Q: products obtained from hydrolysis of DNA by an acid?

A: Acidic hydrolysis of deoxyribonucleic acid (DNA) constitutes the usual way to obtain the…

Q: What are the three possible outcomes of point mutations?

A: A mutation occurs when the sequence of DNA is altered. Mutations can occur as a result of errors in…

Q: Supercoiled DNA is more compact than relaxed DNA of the same molecular weight, which gives…

A: DNA supercoiling refers to the over or under-winding of a DNA strand, and is an expression of the…

Q: Once you had your DNA sample extracted from your cells, why did we add the yellow Master Mix…

A: The DNA sample extracted from the cells is amplified using a method called the Polymerase Chain…

Q: Which of the following statements DOES NOT apply to the Watson and Crick model of DNA? a. The two…

A: In 1953, J.D Watson and F.H.C Crick proposed the three dimensional model of DNA. According to this…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: The single stranded DNA can fold back and base-pair with itself, thus providing both template and…

Q: True or false: During DNA replication, the DNA template is read 3 ́ to 5 ́ by a DNA polymerase, as…

A: DNA replication is a biological process in which two identical copies of DNA are formed during cell…

Q: Human cells have approximatelly 6,000,000,000 base pairs. How many errors per replication occur?

A: Human cells have approximatelly 6,000,000,000 base pairs. How many errors per replication occur?…

Q: In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share all but…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which would you expect to have a higher entropy: DNA in its wellknown double-helical form, or DNA…

A: The entropy of a system decreases when two single stranded DNA molecules come together and form a…

Q: Name: Activity #20: DNA Structure Directions: You may need your textbook to identify the nucleotides…

A: DNA is the double helical structure that is found in the living organisms like humans, plants,…

Q: How would the uniform 2 nm diameter of DNA be affected iftwo purines or two pyrimidines could pair…

A: DNA is called deoxyribonucleic acid. DNA is found in the genome of most of the organism. DNA stores…