A certain small enzyme is needed to extracellularly digest food. The order of the bases on the DNA molecule is ACCAAATCGTTC. What is the order of amino acids on the protein? Explain from start to finish the process by which this protein is created and exported.Please provide all references

A certain small enzyme is needed to extracellularly digest food. The order of the bases on the DNA molecule is ACCAAATCGTTC. What is the order of amino acids on the protein? Explain from start to finish the process by which this protein is created and exported.Please provide all references

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Related questions

Q: You are a molecular biologist studying a defective human protein that is known to be the cause of a…

A: A disease caused by an uncontrolled division of abnormal cells in a part of the body.

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Q: GCA UGC CGA UAC

A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC

Q: Which amino acid(s) have the most codons? Which amino acid(s) have the fewest codons? Can you think…

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: Considering prokaryotes, what is the enzyme that links the tRNA molecules to its correct or cognate…

A: Ans- tRNA molecules serves as the link between the amino acid form of proteins and the genetic code…

Q: The determination of the mass of a protein by mass spectrometry often does not allow its unique…

A: Trypsin : It is an enzyme that helps us digestion protein. In the small intestine, trypsin breaks…

Q: If a protein is created via the translation of 705 nucleotides, including a start and a stop codon,…

A: Central dogma is the process in which RNA is produced from the DNA (transcription) and amino acid…

Q: A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT…

A: Introduction A mutation is a change in the DNA sequence that may occur due to incorrect…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: Name the enzyme responsible for binding of aminoacid to trna?

A: Ribonucleic acid (RNA) is a biomolecule that plays important role in coding, decoding, and…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…

Q: Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…

A: Sickle cell anemia occurs due to point mutation in a gene for hemoglobin. Its symptoms are - fatigue…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: what is post-translational protein covalent modification? give three examples and name the enzyme…

A: Protein post-translational modifications (PMTs) increase the functional diversity of the proteome by…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…

A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…

Q: You are a molecular biologist studying a defective human protein that is known to be a cause of a…

A: It is given in the question that the protein from the cancer patient differs in almost every amino…

Q: In protein biosynthesis, the first codon of the new amino acid chain corresponds to: a. C…

A: The codons are triplets of nucleotides present in the mRNA sequence. There is a total of 64…

Q: Which of the following statements is true regarding the formylmethionine that serves as the first…

A: Introduction Protein synthesis:- The process by which amino acids are linearly arranged into…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…

Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…

A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…

Q: What amino acid does the codon AGC code for? Use the chart below. Thr (threonine) Arg (arginine)…

A: Genetic code was discovered by crick. It is the sequence of nitrogen bases in mRNA molecule which…

Q: A portion of an unknown enzyme has the amino acid sequence leucine – alanine – lysine – tyrosine.…

Q: Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the…

A: Sickle-cell anemia is a genetic disease characterized by the sickle shape of the RBCs. It results in…

Q: Describe the process where a peptide chain is formen from a code embedded in a nucleic acid…

A: Central Dogma of molecular Biology explain how a DNA replication result into DNA, DNA is changed…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: ANSWER;-

Q: A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA…

A: Introduction A silent mutation is a kind of point mutation where the mutation does not affect the…

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…

A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…

Q: Please write primary amino acid sequence with minimum number of amino acids that leads to formation…

A: The primary amino acid sequence is simply the linear arrangements of amino acids that make up that…

Q: Sickle cell anemia occurs due to a point mutation in a gené för changes the amino acid at position 6…

A: Red blood cells are small, round, and convex cells that transport oxygen throughout the body.…

Q: What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read…

Q: Which of the following enzymes adds a new amino acid to the growing chain of a protein during…

A: Introduction Protein Translation: the process of reading mRNA and synthesis of a peptide chain of…

Q: what is the anticodon sequence that would build this protein?

A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…

Q: Lgh ndrome is a metabolic disorder that affects the cetral nervous system a mutation in the MT-ATP6…

A: Proteins are synthesized from mRNAs through translation. mRNAs are synthesized through…

Q: Which group is nonpolar and affects gene expression? Which functional group(s) shown above is (are)…

A: Methyl group (-CH3) is nonpolar and it affects the DNA structure by methylation which causes an…

Q: Please determine the order of aminoacids from a given genetic code? 5’-UGGUACGGUACUCCAC-3’

A: Transcription is the process in which the information present on the DNA is transferred on to a…

Q: You sequence a new tRNA and discover that the anticodon sequence is 5'-IGC-3. What amino acid does…

A: I corresponds to an unusual bas hypoxanthine, which is found in tRNA

Q: Use the codon table to determine one possible DNA sequence that corresponds to the following amino…

A: A sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a specific amino…

Q: Protein sequences are customarily 'reconstructed from sequenced fragments because all of the above…

A: Protein sequencing is a practical method that determines the sequence of amino acids of all or some…

Q: Using the example above, transcribe the following DNA strand into mRNA and translate that strand…

A: During transcription, the enzyme RNA polymerase uses DNA as a template to produce a pre-mRNA…

Q: For each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which…

A: During translation, codons in an mRNA are read, starting with a start codon and continuing until a…

Q: T-A-C |А - А - G А - т-G G-G-G А -т-т DNA enter answer - enter answer enter answer - enter answer…

A: DNA mRNA TAC AUG AAG UUC ATG UAC GGG CCC ATT UAA

Q: In the image below, the blue squiggly line represents a folded protein. There are two particular…

A: Protein is a nitrogenous organic macromolecule that is crucial to human health. It is responsible…

Q: Which of the following is the primary factor that dictates how far a protein will migrate during…

A: The primary factor that dictates how far a protein will migrate during SDS-PAGE is the size of the…

Q: Which of the following mutations in the protein-coding region of a gene is more likely to lead to…

A: A frameshift mutation is a type of gene mutation in which the insertion or deletion of one or more…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the…

A: The genetic code is the set of rules used for translation of the information encoded within genetic…

Q: Which of the following describe how the order of nucleotide bases along a gene in the DNA ultimately…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

please identify amino acids in the N terminus in the picture below.
How would a substitution mutation in the third nucleotide position of the codons for alanine and valine affect the resulting protein?
In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Note, the answer blanks for mRNA may appear vertically on some displays. In this case, enter the bases from top to bottom. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. Enter the full, unabbreviated name of the amino acid in the blank provided. In the case of a stop codon, enter "Stop"
If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTY
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
A small section of bacterial enzyme has the amino acid sequence arginine, threonine, alanine, and isoleucine.The tRNA anticodons for the amino acid sequence shown above is a. GCA UGC CGA UAC b. GCC UGA CGU UAG c. CGA AGA GCC AUA d. GCG UGG CCC UAA
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
What is the resulting polypeptide: _______________________________________________________? What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide. Would this mutation allow the protein for perform the intended function? Why or why not?
The determination of the mass of a protein by mass spectrometry often does not allow its unique identification among possible proteins within a complete proteome, but determination of the masses of all fragments produced by digestion with trypsin almost always allows unique identification. Explain.
What amino acids do the following sequences code for?(a) AUC (b) GCU (c) CGA (d) AAG
If a protein is created via the translation of 705 nucleotides, including a start and a stop codon, how many amino acids are included in the final product?
For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?