a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.)   2. b) Is the top or bottom DNA strand the template strand?

Q: Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA…

A: Cystic fibrosis is a hereditary disease, inherited in an autosomal recessive manner. The cystic…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: 4A.According to Watson-crick base-pairing rule-  Double-stranded DNA is complementary in nature that…

Q: A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-…

A: Restriction endonuclease is an enzyme which cleaves DNA into fragments at  specific location sites…

Q: Explain in not more than 5 sentences. If deoxyribonucleotides that lack the 3’-OH groups are added…

A: Deoxyribonucleotides are the nucleotides which lacks a hydroxyl group at 2' OH of ribose sugar.…

Q: 5. 2) Digestion of a 1.1kb fragment of plasmid DNA with BamHl produces two fragments of 700 bp and…

A: BamHI is a type II restriction endonuclease can identify specific restriction site and induce cut on…

Q: What is meant by a primer, and why are primers necessary for DNA replication?

A: Primers are short DNA or RNA sequences complementary to the existing DNA strands. Without a primer a…

Q: A. If the image below is an electron micrograph showing the result of an experiment in which DNA and…

A: Replication is a process of providing duplication of original data DNA Replication is a process of…

Q: Two circular DNA molecules, which we can call molecule A andmolecule B, are topoisomers of each…

A: Supercoiling of deoxyribonucleic acid (DNA) is the under or overwinding of DNA strands. Supercoiling…

Q: Why did Okazaki propose that lagging strand synthesis proceeds through the synthesis of short…

A: The effective copying of double-stranded chromosomal DNA is required for cellular DNA replication.…

Q: In one, simple sentence define the function of the following 1. Helicase  =  2. Alpha subunit of…

A: DNA helicases are essential during DNA replication because they separate double-stranded DNA into…

Q: Given the following mismatch (highlighted in red), which base will be replaced after mismatch repair…

A: Normal metabolic activities and environmental exposure can cause DNA damage. DNA damage in human…

Q: When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed…

A: It is related to molecular biology in which we use restriction enzymes an important tool for

Q: For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the…

A: The complexity of an organism is based on the functioning of its genome. Deoxyribonucleic acid (DNA)…

Q: Which primer would be appropriate to amplify the top strand of the DNA molecule shown? 5'…

A: Polymerase chain reaction is a method widely being used to make multiple copies of the same DNA…

Q: How often, on average, would you expect a type II restriction endonuclease to cut a DNA molecule if…

A: Restriction endonucleases are enzymes produced by bacteria that cut the DNA at a specific site known…

Q: Using the DNA strand shown here as a template, what will be the sequence of the RNA transcript? 5'…

A: A template is the strand that attach to the complementary strand via DNA polymerase and RNA…

Q: Complete the following table with the proper terms: Process Molecule made name of monomer Name…

A: DNA replication in molecular biology is a biological process through which one double-stranded…

Q: What do you mean by cross-exon recognition complex ?

A: CROSS - EXON RECOGNITION COMPLEX : The sequence of DNA present in mature messenger RNA some of which…

Q: Considering prokaryotes, what is the enzyme that helps hold DNA polymerase III in place when…

A: In prokaryotes, replication is a process by which it makes identical copies of DNA. The process…

Q: 2)For each item in the following table, decide whether it is related or involved in transcription,…

A: DNA is better represented by the central dogma of biology, which is transcribed to RNA, which is…

Q: (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z…

A:

Q: Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA…

A: pUC19 is a plasmid cloning vector developed by Joachim Messing. It is a 2686 base pair containing…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Where would you expect DNA-binding proteins to bind if they recognize a specific base sequence? What…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that transfers genetic information from one…

Q: The sequence below shows the ends of one strand of a linear chromosome, with slashes representing…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Shown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is…

A: DNA is the genetic material of the cell which gets transcribed into mRNA with the help of RNA…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Consider the following sequence of DNA: 3'-TTA CGG-5' What dipeptide is formed from this DNA after…

A: The genetic information is present in the sequences of the DNA. The sequence of DNA that runs in the…

Q: B D A E 1. The RNA primer is denoted by letter 2. The leading strand is denoted by letter 3. The…

A: The DNA replication involves synthesis of new DNA from the old DNA by semiconservative mode. The DNA…

Q: Below are several DNA sequences that are mutated compared with the wild-type sequence. Each is a…

A: Note - Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: (a) What will be the problem during DNA replication if the enzyme primase becomes non-functional?…

A: DNA replication a process by which DNA makes copies of itself and this process requires lots of…

Q: Provide the sequence of the primer that is complementary to the DNA in each of the following…

A: Site A: 5' CTATGCGCTA 3'

Q: ’. Envision that each is a section of a DNA molecule that has separated in preparation for…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: If the DNA duplex for the beta chain of haemoglobin represented by the sequence…

A: Given the template strand in transcription unit is 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' If the…

Q: a) Within Region 1, which strand will be the template for leading strand synthesis, the top or the…

A: Dna replication occur inside the nucleus and it require the enzyme and other replication factors and…

Q: A. In the product, the underlined regions are called what? B. What functional groups are present in…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Introduction : Transcription is the process in which a DNA sequence is transcribed into an RNA…

Q: Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’…

A:

Q: Below is a sequence of DNA.…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: a) What is the sequence of the copy and the template strands? b) If the template strand were in the…

A: A DNA primer complementary to the template DNA (the DNA to be sequenced) is used as a starting point…

Q: In reversible terminator sequencing, how would the sequencing process be affected if the…

A: The basic between sanger's sequencing and reversible terminator sequencing is that Sangar's based on…

Q: Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino…

A: For the synthesis of protein first template strand of DNA is made from coding strand of DNA.…

Q: Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write…

A:

Q: Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA…

A: Mutations can be the change in the sequence of DNA and RNA, and mutations can be caused by a…

Q: For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides…

A: Transcription is the DNA dependent RNA synthetic process. RNA polymerase help in the transcription.…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Blood is a body fluid that carries necessary nutrients and oxygen to the cells and transports…

Q: Given Sequence:

A: The genetic information stored in a cell is transcribed into a messenger RNA by the process of…