Question

A population is made up of individuals where  149 have the A1A1 genotype, 18 have the A1A2 genotype, and 154 have the A2A2 genotype.  What is the allele frequency of A1?  Answer to 2 decimal places.

 

Expert Answer

Want to see the step-by-step answer?

See Answer

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

See Answer
*Response times vary by subject and question complexity. Median response time is 34 minutes and may be longer for new subjects.
Tagged in

Related Biology Q&A

Find answers to questions asked by student like you

Q: Use the data from the table below to answer the questions on an ezyme obtained from potato extract. ...

A: Enzyme activity is regarded as the amount of enzyme that will be required to convert 1 mole of a sub...

Q: If you received a laboratory report showing the presence of a high concetation of ketone bodies in t...

A: Ketones are the substances that are formed when the body breaks down fat particles. These are a type...

Q: Which of the following statements is true? a. once a person reaches maturity, cell division stops un...

A: The process by which a parent cell divides into two or more daughter cells is known as cell division...

Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dn...

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If y...

Q: What are the four different point mutations? How can genetic mutation (genotype) alter protein struc...

A: Point mutations are chromosome rearrangements. They are usually the consequence of errors made durin...

Q: Can you please answer this question 40

A: Alternative splicing is the process in which the mRNA is processed in such a way that one mRNA can c...

Q: Draw and label a simplified model of an atom. Explain how this model misrepresents our understanding...

A: An atom is the smallest component of an element present everywhere in the universe. It is made up of...

Q: When discussing systemic lupus erythematosus (SLE), How can the presence of antibodies cause such wi...

A: Systemic lupus erythematosus is an autoimmune disorder. In this disorder, the body cannot recognize ...

Q: Recombination of alleles in homologous chromosomes occurs during a. anaphase I b. meiosis I c. proph...

A: Eukaryotic cells are denoted either as haploid or diploid, which depends on the number of chromosome...