A replication fork is shown below. The primary enzyme that catalyzes replication is DNA polymerase That enzyme also has a proof-reading mechanis The leading strand would be the [ Select ] Helicase is a(n) enzyme [ Select ] double helix to the right side bottom strand top or bottom strand, since they are complementary. top strand left to right 3'

A replication fork is shown below. The primary enzyme that catalyzes replication is DNA polymerase That enzyme also has a proof-reading mechanis The leading strand would be the [ Select ] Helicase is a(n) enzyme [ Select ] double helix to the right side bottom strand top or bottom strand, since they are complementary. top strand left to right 3'

Name: A replication fork is shown below. The primary enzyme that catalyzes
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A replication fork is shown below. The primary enzyme that catalyzes replicationisDNA polymeraseThat enzyme alsohas a proof-reading mechanisThe leading strand would be the[ Select ]Helicase is a(n) enzyme[ Select ]left to rightdouble helix to the ri

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 4P: Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram...

See similar textbooks

Similar questions

Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)
Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a) origin of replication, (b) polarity (5′ and 3′ ends) of all template and newly synthesized strands, (c) leading and lagging strands, (d) Okazaki fragments, and (e) locations of primers.
What statement(s) apply to both eukaryotic and prokaryotic replication? Select all that apply. a. There is a single origin of replication. b. Replication is discontinuous on the lagging strand and continuous on the leading strand. c. The sliding clamp is composed of PCNA. d. Telomeres are replicated by telomerase. e. Helicase unwinds the helix. f. Replication is continuous on the lagging strand and discontinuous on the leading strand.
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
Which statements are true? Explain why or why not.1 The different cells in your body rarely havegenomes with the identical nucleotide sequence.2 In E. coli, where the replication fork travels at 500nucleotide pairs per second, the DNA ahead of the fork—in the absence of topoisomerase—would have to rotate atnearly 3000 revolutions per minute.3 In a replication bubble, the same parental DNAstrand serves as the template strand for leading-strandsynthesis in one replication fork and as the template forlagging-strand synthesis in the other fork.4 When bidirectional replication forks from adja-cent origins meet, a leading strand always runs into a lag-ging strand.5 DNA repair mechanisms all depend on the exis-tence of two copies of the genetic information, one in eachof the two homologous chromosomes
You figure out a way to replicate DNA in a test tube by adding double-stranded DNA template, dNTPs, NTPs and all the proteins needed for replication. However, you forget to add DNA ligase. In a well-labelled diagram, fill in the following parts of the growing replication fork shown. 1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label the new strands as “leading” or “lagging”, Label the 5’ and 3’ ends of all nucleic acid strands that you draw, Draw a circle representing the location of DNA helicase (do not include any other proteins in your drawing)