A study by Bose and colleagues (1998. Blood 92: 3362–3367) and a previous study by Biernaux and others (1996. Bone Marrow Transplant 17: (Suppl. 3) S45–S47) showed that BCR-ABL fusion gene transcripts can be detected in 25 to 30 percent of healthy adults who do not develop chronic myelogenous leukemia (CML). Explain how these individuals can carry a fusion gene that is transcriptionally active and yet do not develop CML.

A study by Bose and colleagues (1998. Blood 92: 3362–3367) and a previous study by Biernaux and others (1996. Bone Marrow Transplant 17: (Suppl. 3) S45–S47) showed that BCR-ABL fusion gene transcripts can be detected in 25 to 30 percent of healthy adults who do not develop chronic myelogenous leukemia (CML). Explain how these individuals can carry a fusion gene that is transcriptionally active and yet do not develop CML.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter12: Genes And Cancer

Section: Chapter Questions

Problem 13QP: The search for the BRCA1 breast cancer gene discussed in this chapter was widely publicized in the...

See similar textbooks

Similar questions

Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion protein: ATATGCATCACCATCACCATCACATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAA
Mutational signatures of p53 are shown in this image (G.P. Pfeifer et al., Nature, 21(48), 2002) for the three types of cancer with the highest death rates in the United States: lung (~225,000 deaths in 2016), breast (246,000), and colorectal (381,000). These data can be obtained by sequencing the gene that encodes p53. Approximately 85 percent of lung cancers occur in smokers. Based on these data, calculate how many deaths due to lung cancer among nonsmokers were reported in 2016. How much does smoking increase the likelihood of death due to lung cancer?
Below is a figure (here called Figure 1) from “Prognostic Significance of CpG Island Methylator Phenotype and Microsatellite Instability in Gastric Carcinoma,” by An et al., published in Clinical Cancer Research in 2005. The authors look at five microsatellite loci (BAT 25, BAT 26, D2S123, D5S346, and D17S250) in normal (N) and tumor (T) tissue from patients with Gastric Carcinoma. They amplify the loci by PCR and then instead of using standard agarose gel electrophoresis, they run the PCR products through capillary gel electrophoresis and detect bands as they pass a laser near the positive charge terminal. The x-axis in these plots is the time at which the band passed the laser (aka size of the PCR product) and the intensity of the peaks represents the amount of DNA in that band A. Which patient- 18, 30, or 1- shows the most microsatellite instability? Which patient shows the least? How do you know? B. In which repair pathway is it most likely that you will find the driver mutations…
Can you please help me by drawing a serie of schematic figures that demonstrates the information in the paragraph below. The carboxy terminus of the p53 protein acts as an allosteric regulator of sequence-specific DNA binding. This was demonstrated initially by Hupp et al. (1992) using a bacterially expressed protein. Recombinant bacterial p53 bound poorly to DNA, and binding could be enhanced by the addition of antibodies specific to the C-terminal region of the protein. Phosphorylation of Ser315 and Ser392 within this domain also enhance sequence-specific DNA binding. Dephosphorylation of Ser376 of p53 after IR allows the association of 14-3-3 proteins with the C terminus of the protein (Waterman et al., 1998). Stavridi et al. (2001) demonstrate that this interaction is required for p53 to activate the downstream gene, p21waf1/cip1, and for the G1 cell cycle checkpoint arrest response. Interestingly, this dephosphorylation event seems to be ATM-dependent, possibly by a phosphatase…
Transformation is a process in which bacteria take up new DNA released by dead cells and integrate it into their own genomes (see p. 265 in Chapter 9). In Streptococcus pneumoniae (which causes many cases of pneumonia, inner-ear infections, and meningitis), the ability to carry out transformation requires from 105 to 124 genes, collectively termed the com regulon. The com regulon is activated in response to a protein called competence-stimulating peptide (CSP), which is produced by the bacteria and exported into the surrounding medium. When enough CSP accumulates, it attaches to a receptor on the bacterial cell membrane, which then activates a regulator protein that stimulates the transcription of genes within the com regulon and sets in motion a series of reactions that ultimately result in transformation. Does the com regulon in Streptococcus pneumoniae exhibit positive or negative control? Explain your answer.
In the experiment summarized below, scientists were examining the presence of specific sequences in individuals with age. In this experiment they extracted DNA from lymphocytes of various aged individuals and measured the length of a TTAGGG (in kb) repeat they found in their genomic DNA (Left Panel). In the right panel, the scientists measured the length of the same repeats in individuals with lymphocyte failure (red dots most severely effected) that have a mutation in a critical enzyme. Answer the following questions in 2-3 sentences each. A. What is the name of the specific sequence the scientists are measuring in the experiment shown below. B. For the individuals with lymphocyte pathology in the right panel, which gene is likely defective that causes the data shown? C. Explain why the length of the repeat sequence decreases with age.
You identify a mouse mutant that has hemophilia and is unable to properly clot blood. Your assays reveal that a novel clotting factor is absent from the blood of the mutant mice. You sequence the genome of the mutant mouse and determine that clotting factor proteins normally associated with hemophilia are all wildtype (no mutations), but the coding sequence of the novel protein differs by one amino acid compared to wildtype. When you synthesize the mutant protein in vitro, it has normal blood clotting activity. Your controls using other mutant hemophilia clotting proteins fail to clot blood in this assay. What would you say the mutant protein results in hemophelia?
The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globin
BRCA1 is mutated in a large percentage of hereditary breast and ovarian cancers. BRCA1 protein serves as a key enzyme in repairing DNA double-strand breaks. More than 800 mutations in the BRCA1 are clinically significant. This collection of mutations include missense mutations, small deletions, and large rearrangements that result in a protein with reduced function or no protein product. BRCA1 functions by interacting with a variety of proteins, such as Rb, Myc, cyclin-dependent kinase (CDK), and Rad50/51. Rb is important for cell cycle arrest; Myc is a transcription factor that activates genes required for cell proliferation; activated CDK promotes cell cycle progression; and Rad50/51 proteins facilitate repair of DNA double-strand breaks. How many of the mutations listed below would lead to excessive cell growth when the cell was either homozygous or heterozygous for the mutation? Increased expression of Myc Constitutively active Rad50/51 A null mutation in Rb Continuous production…
Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute myeloid leukaemia Select one: A.t(8;21) translocation (RUNX1‐RUNXT1 fusion) B.DNMT3A mutation C.TP53 deletion D.NPM1 (nucleophosmin) mutation
A research group is studying a bacterium X that binds to mucosal cells in the lung and invades. Wildtype X has an LD50 value of 10 bacteria when administered to mice by inhalation. Using transposon mutagenesis, the researchers have isolated two mutants of X that they call Xmut1 and Xmut2, both of which have LD50 values of 105 when inhaled by mice. However, in tissue culture cells, Xmut1 can invade the cells just as well as wild-type X, while Xmut2 cannot. Provide a possible explanation for these results.
The haemoglobin proteins of RNA polymerase ii sub units RPB1-P24928 RPB2-P30876 RPB3-P19387 RPB4-015514 are they similar? Explain?