A tRNA is charged with the amino acid methionine.(i) Give the anti-codon of this tRNA.(ii) Write the Codon for methionine.(iii) Name the enzyme responsible for binding of amino acid to tRNA

Q: UAA is a stop codon. Why does the UAA sequence in the segment of mRNA…

A: Stop codons do not specify any amino acid. When ribosome faces any stop codon, it stalls. When the…

Q: The anticodon of a tRNA is 5' AAU 3' a. What codon does the tRNA recognize? b. What amino acid does…

A: BASIC INFORMATION  TRANSLATION  It is the process through which the proteins are made with the…

Q: Which enzymes and tRNAs are known as aminoacyl-tRNA synthetases?

A: BASIC INFORMATION ENZYMES They are the catalyst. They help in accelerating the chemical reaction.…

Q: the function of the small ribosomal subunits is

A:

Q: How is each tRNA charged with the correct amino acid? What are the consequences of a tRNA carrying…

A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a courier RNA (mRNA)…

Q: The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it…

A: Introduction  In the protein translation process, the key role is played by the tRNA which…

Q: A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA…

A: Correct answer is option... B. Translation stops and the protein is released

Q: Draw a tRNA that would recognize the codon 5’ A U G 3’. What is the sequence of this tRNA’s…

A: The tRNA (transfer RNA) take part during the translation process. It is responsible for delivering…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: Describe translation. What is the function of the aminoacyl-tRNA synthase?

A: Protein synthesis: It is a process that involve peptide bond formation between the amino acids by…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: Describe what is the function of the anticodon of a tRNA?

A: The biological instruction manual known as DNA, sometimes called deoxyribonucleic acid, provides…

Q: What are the function of initiator Trna?

A: Initiator tRNA is the tRNA that brings the first amino acid for the synthesis of proteins.

Q: During Chain ________ Each Incoming Aminoacyl-tRNA Moves Through Three Ribosomal Sites.

A: The process of translation is the process by which the information stored in the DNA is converted…

Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: A mutation to a tRNA with the anticodon of AGG changes the amino acid bound to the TRNA from serine…

A: Mutation refers to alterations in the DNA sequence. These alterations can either be produced due to…

Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…

A: Anticodon is a sequence of three nucleotides on a tRNA molecule that bind to a specific…

Q: Why must tRNA molecules have both unique structural features and common structural features?

A: An adaptor molecule that contains a certain AA (amino acid) to the “messenger ribonucleic acid”…

Q: Describe the structural features that all tRNA molecules have in common.

A: Introduction  tRNA is also referred as Transfer RNA which has a 3D structure like clover leaf. It…

Q: What are the three functional parts of the tRNA and what is their importance to translation?

A: Transfer RNA or tRNA generally contains 76-90 nucleotides and acts as a physical link in between…

Q: Give the structure of Trna,the adapter molecules?

A: An adaptor molecule is typically a "bridge" between other molecules, often one which allows…

Q: In which of the ribosomal sites, the A site, P site, and/or E site, could the following be found? A.…

A: Ribosomes are small and round bodies that are either found floating freely in the cytoplasm, or…

Q: Would you expect tRNA or mRNA to be more extensively hydrogen bonded? Why?

A: RNA is a polymer of nucleotide where it is composed of a ribose sugar, phosphate group, and a…

Q: The peptide bond formation is catalyzed by a. the aminoacyl tRNA synthetase b. tRNA c. the small…

A: Translation is a method or process by which the message on the messenger RNA is converted into a…

Q: A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce…

A:

Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…

A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…

Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?

A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…

Q: Can a tRNA exist that has the anticodonsequence 5′ IAA? If so, which amino acidwould it carry?

A: Transfer RNAs (tRNAs) are essential in protein synthesis and elongation. The sequence on the mRNA…

Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?

A: RNA- It  stand for the ribonucleic acid.  is a nucleic acid present in all living cells and in some…

Q: Describe the key structural features of a tRNA molecule.

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…

Q: What are the two key functional sites of a tRNA molecule?

A: tRNA (transfer ribonucleic acid) is the type of RNA molecule that takes part in translation of…

Q: which level of structure describes  non watson crick intercations in trna

A: According to Watson and crick, the DNA is a nucleotide, it is made up of sugar, nitrogenous base,…

Q: Identify and define the two essential structural areas of a tRNA molecule

A: Transfer RNAs are coded by a number of genes, and are usually short molecules, between…

Q: Label the following regions on this tRNA molecule, stating the function of each:

A: This is a tRNA molecule. It has an amino acid arm where the corresponding amino acids bind. It has…

Q: Why don’t cells need one tRNA for each codon?

A: tRNA : Transfer RNA : It is a type of a molecule that helps decode mRNA sequence into protein.…

Q: A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's…

A: RNA is Ribonucleic acid which is formed from DNA via the process of transcription . It takes place…

Q: help

A: Translation is the process for synthesizing the protein from mRNA by the action of ribosomes. It…

Q: What characteristic of the genetic code explains why a substitution mutation in a codon contained…

A: Codons are sets of three nucleotides responsible for the detection by tRNA for the type of amino…

Q: When you add new tRNAs, what happens to the green amino acids they carry at the top of each tRNA?

A: In any cell the DNA ultimately form functional protein and for this every cell form a process called…

Q: The job of tRNA is to?

A:

Q: Which amino acid would be attached to a tRNA that read "GGU"?

A: Introduction :  A codon is defined as a sequence of three nucleotides which together form a unit of…

Q: A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA…

A: Protein synthesis happens by a series of events. mRNA transcripted from DNA had the codons. tRNA has…

Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?…

A: We know that the mRNA carries the codon and the tRNA carries the anticodon. The transfer RNA is the…

Q: What is the basic purpose of tRNA?

A: All the information needed to maintain is present in the DNA inside the nucleus. RNA helps in the…

Q: How is ATP used to charge a tRNA?

A: Adenosine triphosphate (ATP) is an energy source required to the body to perform various cellular…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.