а. ААBВ х ааBB . AаBB х ААBЬ -. АаBb x аabb Н. АаBb x AaBВЬ

Q: 27 28 26 25 29. 30. 24 31 23 32 22 33 34 20 P -w² 19 8 15 16 72hr chicken embr Transverse section…

A: Embryology is the branch of biology that studies embryogenesis, or the formation of an embryo out of…

Q: irection: Draw a smiling face (O) if the ngineering and (O if not.

A: When genes of an organism are changed or edited with aid of biotechnology, the process is termed…

Q: jactorie Memoglobin's affinitygou eveygón. 81) What aue the reél that affect

A: The continuous link between haemoglobin oxygen saturation and oxygen tension is known as haemoglobin…

Q: Cat trachea, c.s Identify the cells labeled B.

A: the first figure shown is the cat trachea cross section . the figure marked as A is the hyaline…

Q: 1/V, uM'min x 10 40 30 20 10 y-Intercept x-intercept

A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation energy…

Q: ₃₀. ɪꜰ ʏᴏᴜʀ ʙɪʀᴛʜᴅᴀʏ ɪꜱ ᴏɴ ᴀ ᴍᴏɴᴅᴀʏ ᴛʜɪꜱ ʏᴇᴀʀ ᴀɴᴅ ɴᴇɪᴛʜᴇʀ ᴛʜɪꜱ ʏᴇᴀʀ ɴᴏʀ ᴛʜᴇ ɴᴇxᴛ ʏᴇᴀʀ ɪꜱ ᴀ ʟᴇᴀᴘ…

A: Note: since you have asked multiple question, we will solve the 2nd question for you. if you want…

Q: Can someone give another answer for c?

A: In genetics, the alleles forms the alternative form of the genes that carry the hereditary…

Q: B A E D N F MIIC M K

A: Introduction: A group of genes that code for proteins found on the surfaces of cells that help the…

Q: 7(а) OH SH NH2 7(b) HO HO HOT O- HO O. HO, HO, OH 7(c) HO 7(d) -NH2 OH HO OH

A: All living forms on this earth are based only on these carbon-based molecules and this is what we…

Q: Which one shows a Tm?

A: Kidney is the chief excretory organ in the humans. Nephrons are the structural and functional unit…

Q: D A B C

A: In the frog dissection, abdomen part and upper thoracic part is shown.  A. Spleen :- It is dark red…

Q: bive tho disorders are affe affect

A: The gastrointestinal tract consists of the mouth, esophagus, stomach, small intestine, large…

Q: Identify the circled functional groups and linkages in the compound shown below.

A: Functional groups are specific substituents or moieties within molecules that may be responsible for…

Q: Acohort study is CO

A: Cohort study is a type of longitudinal study that follows group of people or research participants…

Q: 4. HCHO + KMNO4 _(4a)_ (4b)_+ K2SO4 +| MnO2l + H2O

A: Asked : To complete the given reaction

Q: notice spot accidentally b frightened sure C

A: Synonyms are two words or phrases that have the same meaning and can be substituted for one another…

Q: hote: Add five letters. C2 =D C3 = C4 = a. 109.5° b. 120° C. 180° IL || ||

A: The bond angle in an organic compound depends on the hybridization state of the carob atom involved…

Q: Please check if i draw non disjunction for mieosis I corrcectly. Also need help with drawing of non…

A: Non disjunction is a condition in which the homologous chromosomes are unable to separate in the…

Q: 15 11

A: Spinal cord is a long, tubular structure of the nervous system. It arises from brainstem and extends…

Q: R M

A: Sheep brain sagittal view: Introduction: A sheep's brain is extremely similar to that of a human.…

Q: Vhich label represents the H zone?

A: The H zone is  LABEL C

Q: H;C. NH QH HO-P=0 ÓH A True B) False

A: Thymidilic acid is a part of DNA. It is exclusively found in DNA and not in RNA. Thymine is a…

Q: B A - 1. Identify: a. Name of specimen? b. B? c. C? (region) d. A? (continuation of C towards the…

A: A) Dicot stem-(like sunflower stem.) B)Vascular bundle (labeled part B)

Q: 1. 2 3 4 4. 5. 6. 7. 8. 9. 10. 11 12 13. (b)

A: 1) Urinary bladder 2) Seminal vesicles 3) Vas deferens 4) Prostate gland 5) Bulbourethral gland  6)…

Q: 6. Drugs usedprimarilyfor infiltration and conduction anesthesia: A. Procaine. B. Articaine. C.…

A: Local infiltration anesthesia is the procedure of creating loss-of-sensation limited to a…

Q: किठoहेण्रोक ो8 मलेटन्य मेठ वड़ Smpie बकd शfo usta ४ eb0 Tयंल (०) ট) om)०ठकब्ब वकव हानकवारड १००१ ern)…

A: For humans, oxygen is an essential gas. It is essential for aerobic respiration, which generates…

Q: al iA . 14 rb sr n -- 15 16 ns abs 17 · 18 ·19 20 22 21

A: Lungs are a component of the respiratory system, which is made up of a collection of organs and…

Q: Please help

A: All these terms are different scientific terms which are hidden in this puzzle. The arrangement of…

Q: se two re IS CO

A: The body requires some elements to grow, develop, and perform functions. The body gets these…

Q: or anim A. tume e challer - of the Ils simila st organm

A: DNA (Deoxyribonucleic acid) is the hereditary unit of an organism. The DNA is formed of a specific…

Q: S.L.U (N: 54 (N: 66 D.H.E.A. -S 252 (N: 65 (N: 71 (N: 3-

A: Ages 10-18 : 55 to 307 micrograms per decilitre Ages 18 to 19: 145 to 395 micrograms per deciliter…

Q: O GCATGCT O ATGCATC O TCGTACG O CTACGTA

A: Maxam-Gilbert sequencing was initially more popular, in the end, Sanger sequencing won thanks to its…

Q: Define the following terms: a. NPY/AgRP b. POMC c. NTS d. leptin e. α-MSH

A: Introduction: Hormones are produced by the endocrine glands and transported to the target organs or…

Q: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT -TGG-AAT-GTG-CCA-AAG-TTG-CAG-TGA-AGG-TG…

A: Introduction: Proteins are made up of amino acids. The name amino acid comes from the fact that it…

Q: can you suggesst treatment

A: A common electrolyte problem is hypernatremia, which is defined as a rise in serum sodium content to…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: ترتا NH, SH NH, H H H он NH PEPTIDE RNGCSN *NH, H H H d.

A: Trypsin is a proteolytic enzyme. It catalyzes the hydrolysis of peptide bonds. It is one of the…

Q: C. Dura m

A: Histology is the study of the microanatomy of cells, tissues, and organs as seen through a…

Q: Clarify the use of the D and L designation vs. the (+) and (-) signs

A: Introduction D-L system (also called Fischer–Rosanoff convention) is used for naming α-amino acids…

Q: Heght A TT x tt GR PR F'itr poton 2) Aa aa GR PR

A: Answer :  Phenotypic ratio-  It is ratio of Calculable relationship between phenotypes showing the…

Q: M S R E P

A: 1. The process name is fragmentation. CTC process when a new organism is developed from the parent…

Q: F A E D 'В G C

A: Respiratory system Respiration is a process of breathing in which inhalation of oxygen and…

Q: T7Q यदि AA= 10 एवं aa = 0 है तो अति प्रभाविकता का उदाहरण होगा ? (1) Aa = 5 (2) Aa = 7 (3) Aa = 10…

A: Answer :-   जब दो विपर्यासी लक्षणों का आपस में काम कराते है तो, F1 , पीढ़ी में प्रभावी तथा अप्रभावी…

Q: 85 84 83 B6 88 B9 B10 B12 B13 B14 B15

A: Since the guildlines permit me to answer first three questions i will do so to the best of my…

Q: 12 v A A B I U Ov Av . EE E A Or ...

A: 4. a. These are animal cells. b. The dark blue circles inside the cells are the nucleus. c.…

Q: es Bl Gy Ay Va 8 V, V. V, a, a, , Ya

A: The hypothesis stands void as the Beta globin gene is being derived from 3 genes out of which none…

Q: 0-CH,CH,-N(CH,)3 0=P-0 Он-СН— CH-CH2 CH NH 1. C=0 CH (CH,)12 (CH,)10CH, CH3

A: Phospholipids are made up of four components: an alcohol (glycerol or sphingosine), fatty acids,…

Q: Find the gradient between Letters D& F. Gradient- ED/HD

A: Prior in the semester, you were acquainted with the idea of isoline (or isopleth or isarithm) maps.…

Q: G I J K D. E F

A: The function of the reproductive system includes 1. Main function of the Reproductive system…